smaller downloadDBs #66
Comments
|
Great you did this as I am having trouble to get the DBs work. I downloaded https://edwards.sdsu.edu/SUPERFOCUS/downloads/conda/diamond_v1/98_clusters.db.dmnd.zip, however, I do get the warning Did I misunderstand your instructions? Which file should work with diamond v0.9.24.125? FWY, I also tried https://edwards.sdsu.edu/SUPERFOCUS/downloads/conda/diamond_v3/98_clusters.db.dmnd.zip with the same error. |
|
Hi @StefPN, it looks to me that the DIAMOND version you used is different from the one @linsalrob. You can always download the raw FASTA and format it yourself as it has on the tool README file. Let me know how it goes |
|
@StefPN I'm at work right now. I will get back to you with more details this weekend, ok? |
|
According to the diamond help page,v0.9.19 to v0.9.24 produce and accept format version 2, which of course is the only version I did not include. I will attempt to install and include that version here. |
|
@StefPN I have updated the comment here with revised locations for all the databases. Can you use the correct version for your |
|
Dear Rob, I do not see anything wrong with my fastq file. What could be the problem? |
|
This is the diamond database, so change `-a blast` to `-a diamond`
Rob
…On Mon, Aug 24, 2020, 4:04 PM StefPN ***@***.***> wrote:
Dear Rob,
Thank you very much! I now downloaded the 98 v2. When I start running SF,
I do not get the DB error I got before. However, unfortunately I get the
following error:
superfocus -q SUPERFOCUS/ -dir SUPERFOCUS/output/ -db DB_98 -a blast
[2020-08-24 08:25:01,838 - INFO] SUPER-FOCUS: A tool for agile functional analysis of shotgun metagenomic data
[2020-08-24 08:25:01,841 - INFO] 1.1) Working on: NC.01_R1.fastq
[2020-08-24 08:25:01,841 - INFO] Aligning sequences in NC.01_R1.fastq to 98 using blast
BLAST query error: CFastaReader: Near line 1, there's a line that doesn't look like plausible data, but it's not marked as defline or comment.
[2020-08-24 08:25:01,938 - INFO] Parsing Alignments
Traceback (most recent call last):
File "/home/stefanie.prast/.local/bin/superfocus", line 11, in `<module>`
load_entry_point('superfocus==0.0.0', 'console_scripts', 'superfocus')()
File "/home/stefanie.prast/.local/lib/python3.7/site-packages/superfocus-0.0.0-py3.7.egg/superfocus_app/superfocus.py", line 342, in main
del_alignments)
ValueError: not enough values to unpack (expected 2, got 0)
(base) ***@***.*** ep]$ head SUPERFOCUS/NC.01_R1.fastq
@M01548:130:000000000-BBN6D:1:2106:18580:4509 1:N:0:TCCGGAGA+CCTATCCT
TAAAACCGGGAAATGGACCGATGCCCGTTCTTATCTTACAAACATGGGCATTGATAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAAGCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAATGAAAAAAAAAAAGATGAGAGGCAAAAAACACAAAACATTAAAATAGAAGTGAGACATGTATAGAGAGAAGAGAGAAGAAAAGTATGAGCGGAGTAGAGACGTCAGGTGACGTAAGCTGTAGTACGATAGTTAAATTGAGTTCTAACAAGTAGAGAGAGTACTGTGA
+
***@***.***@@***@***.******@***.******@***.***@***@***.***:7=CF,4:=:CC8F<AF+8E+5,C5,CFCF<EEFCF@***@***.******,,,,,,***,,6***,,,*,4,*,,++,,52+++++++2+5*++35959+3+/*+*+***/+*+0**++++3++**)*)**+*+***/)*)**+1+)10*)+*0*0*2)*0*(10*)*./)*-*)/*).*-))*()1))))(,(.:).-4))
@M01548:130:000000000-BBN6D:1:2106:16678:4867 1:N:0:TCCGGAGA+CCTATCCT
GATATTTTTCTCTTCAGTGATGCTGCACTGGAAAGTAACGCCGGGGAATGCTTACAACCAGCCAAGGGGATCTCGAGAATGATTCTGCCTAGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACACACGCTACCCAACCACCCTTCTCTACGCTCTCTTTTACTTATACTGCCCTAGCCTCACACCCCCCATCTTACCTCCATTCACCTTCCTTCACCGCCCTCTCCACCACCTACATTCTACACCTCCTCA
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGG,?FFGFGGGGGGFGDGGGGGG9FFGGGGGGGGG**5*>,,**4*6:,:<***6*1***5>+@+5*3*/*++5;++++++2+=+1+2*0**+*+2+*+*/)/)*)28C*+*08C5*977C*:)*)*)***)2(),),)(0)-()(((0(.).))))-)((((243.
@M01548:130:000000000-BBN6D:1:2106:28259:8664 1:N:0:TCCGGAGA+CCTATCCT
CTGGGCACCACCGGTGCAGTGAACCATACCGTGAACCTCTGGGCGGAGCTCATCGAGAATCTTCTTGATGACAGGAGCGTAGGTACGGGTAGGAGAGAGTACCAGTTCTCCGGCATTGATAGGTGAACCCTCTACCTCATCAGTCAACTTATACTTACCGCTGTAAACCAACTCCTCTGGCACGGCGTGGTCGTAGCTCTCAGGATAGTTCTCTGCGAGATACTTGGCGAATACATCGTGGCGGGCAGAAGTCAAACCGTTGCTGCCCATACCGCCGTTGTACTTCTTCTCGTAAGTAGCC
I do not see anything wrong with my fastq file. What could be the problem?
Thank you very much for your help!
—
You are receiving this because you were mentioned.
Reply to this email directly, view it on GitHub
<#66 (comment)>,
or unsubscribe
<https://github.com/notifications/unsubscribe-auth/AAGMFB4LFKWVYTUD4X6N7ALSCICVZANCNFSM4PWIXWWA>
.
|
|
Of course! Sorry, I was not paying enough attention when copying the code this morning. It seems to be running now. Thank you! |
|
Are you running two superfocus commands at the same time? I think you will
need to run one and wait for it to finish and then run the other. Or run
them in separate directories.
Rob
…On Mon, 24 Aug 2020 at 22:10, StefPN ***@***.***> wrote:
So, while the db seems to be correct now, I get another error:
`Deallocating taxonomy... [8e-06s]
Total time = 724.78s
Reported 29736263 pairwise alignments, 29750338 HSPs.
1632832 queries aligned.
diamond v0.9.24.125 | by Benjamin Buchfink ***@***.***
Licensed under the GNU GPL https://www.gnu.org/licenses/gpl.txt
Check http://github.com/bbuchfink/diamond
<https://github.com/bbuchfink/diamond> for updates.
#CPU threads: 40
Loading subject IDs... No such file or directory
[0.000217s]
Error: Error opening file SUPERFOCUS/output/PA.01.fastq_alignments.daa
rm: cannot remove ‘SUPERFOCUS/output/*.daa’: No such file or directory
`
The only files created up to this step are:
-rw-rw-r--. 1 stefanie.prast users 0 Aug 24 08:20 NC.01.fastq_alignments
-rw-rw-r--. 1 stefanie.prast users 0 Aug 24 08:25 NC.01_R1.fastq_alignments
-rw-rw-r--. 1 stefanie.prast users 1146346 Aug 24 13:55
NC.01_R1.fastq_alignments.m8
-rw-rw-r--. 1 stefanie.prast users 0 Aug 24 08:21 PA.01.fastq_alignments
Note that NC.01 was processed first, without any error reported. This is
the negative control, so a very very small file.
What could be the problem now?
—
You are receiving this because you were mentioned.
Reply to this email directly, view it on GitHub
<#66 (comment)>,
or unsubscribe
<https://github.com/notifications/unsubscribe-auth/AAGMFBZGJNXUNDHT4C2ZP2LSCJNUJANCNFSM4PWIXWWA>
.
|
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
I premade the databases for conda download.
Please check your
diamondversion withdiamond --versionand then read the diamond documentation to know which version to download. You can also find out the database version you have installed withdiamond dbinfo.After downloading, you need to copy these to
lib/python3.8/site-packages/superfocus_app/db/static/diamondin the same location as superfocus:e.g. for
90_clusters:These are smaller downloads than the raw files (
db.zipis 3.3 GB)The text was updated successfully, but these errors were encountered: