Fix emboss tool versions

[rogmei]

The tool sixpack on usegalaxy.eu only acepts fasta files, but throws an error every time I try.
Have tried both single fasta and multifasta, always with the same result.
Under is an example of a fasta that fails in Galaxy. Pasting this same sequence into the EMBOS online sixpack tool works.
Other Galaxy tools like seqret does work.

The Galaxy error:

An error occurred with this dataset:
format sixpack database ?
Died: Value required for '-uppercase' before '-number'

contig_10
TGAAATGAATGATAAGCCAGTTTTGTTGTCAAATAGTTTCTGTGTGGCTTCGGTAGATAA
TATCGATAGGAATAGTGCTTATGCATCAGTTAAAGTTGGTGAGGCTAATAGAGGATTTCA
TGGAACTTCTGTTCAGTCTGTAGAGCCTTTGCCTATTTCAACCTCAGTCGGAAGGACTGC
TTGTAATTCGTTACATACTTCCAGTAGAGTTGGTCAACAAAGCAATTTGTCAGCTGCAGA
TATCAGGGATTATCAACACACTTTTACTCAAACTTCTCATTCAGAAGTTACATCTTATAG

[bernt-matthias]

Thanks for reporting. Which tool version do you use and on which galaxy are you working? Can you tell us which non default parameters values you are using? If you see the executed command line in the dataset info page this would also be of interest.

[rogmei]

Hi Thanks for getting back to me. Using default values on https://usegalaxy.eu/ sixpack Display a DNA sequence with 6-frame translation and ORFs (Galaxy Version 5.0.0.1) toolshed.g2.bx.psu.edu/repos/devteam/emboss_5/EMBOSS: sixpack90/5.0.0.1 For each run of sixpack singlefasta or multifasta, two separate instances opens. I guess this is divided in the three forward and three reverse reading frames. Regardless it always ends with this error message after a short time running. ***@***.*** Hope you can find out what is going wrong here. Best regards Roger Fra: M Bernt ***@***.***> Sendt: fredag 7. oktober 2022 08:43 Til: galaxyproject/tools-iuc ***@***.***> Kopi: Roger Meisal ***@***.***>; Author ***@***.***> Emne: Re: [galaxyproject/tools-iuc] Sixpack tool not working (Issue #4829) Thanks for reporting. Which tool version do you use and on which galaxy are you working? Can you tell us which non default parameters values you are using? If you see the executed command line in the dataset info page this would also be of interest. - Reply to this email directly, view it on GitHub<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fgalaxyproject%2Ftools-iuc%2Fissues%2F4829%23issuecomment-1271175568&data=05%7C01%7Croger.meisal%40moreforsking.no%7C8794aa3269a74146266a08daa82f296b%7C2e4369cbe2f24bb4b3b0007916c19c7b%7C0%7C0%7C638007217775543817%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=2uT60fy6Nfp6%2FC9RJ%2BA2EaOjVMTDnpHzN1whnHgwwp8%3D&reserved=0>, or unsubscribe<https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAWJO4AX2VPFI5LL5HIE74G3WB7A6ZANCNFSM6AAAAAAQ4QQ23Q&data=05%7C01%7Croger.meisal%40moreforsking.no%7C8794aa3269a74146266a08daa82f296b%7C2e4369cbe2f24bb4b3b0007916c19c7b%7C0%7C0%7C638007217775543817%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=mFbVIejrNFzI6ErhEPFIh05iqp1AdiB2%2FtrxgsX4Pd0%3D&reserved=0>. You are receiving this because you authored the thread.Message ID: ***@***.******@***.***>>

[bernt-matthias]

@rogmei plase share the history or data set and post the link

[rogmei]

https://usegalaxy.eu/u/8b383e1220ee48ae84c86849cc93bdf9/h/sixpack-problem
Here is an example history using a single fasta file as input.

[bernt-matthias]

Seems that we messed up the versions. 5.0.0.1 is not the latest version, but 5.0.0+galaxy2 as a workaround you can manually switch the version on the top of the tool form (the button with the 3 boxes on the top right.

I guess to fix this we need to readd .1 to the tool versions

[rogmei]

Thanks for solving this.
Switching versions works.
Would never have guessed this had to do with a version conflict.

[rogmei]

Solved