Add sequence adapter for viewing and retrieving sequences

.github/workflows/pull_request.yml

@@ -4,7 +4,7 @@ on: pull_request
 
 jobs:
   build:
-    name: Strict lint
+    name: Strict lint and test
     runs-on: ubuntu-latest
     steps:
       - name: Check out
@@ -19,3 +19,5 @@ jobs:
           install-command: yarn --immutable
       - name: Lint codebase
         run: yarn eslint --report-unused-disable-directives --max-warnings 0 --ext .js,.ts,.jsx,.tsx .
+      - name: Test codebase
+        run: yarn test

package.json

@@ -13,7 +13,8 @@
     "start:shared": "yarn workspace apollo-shared run start",
     "start:server": "yarn workspace apollo-collaboration-server run start",
     "start:plugin": "yarn workspace jbrowse-plugin-apollo run start",
-    "start": "npm-run-all --print-label --parallel start:shared start:server start:plugin"
+    "start": "npm-run-all --print-label --parallel start:shared start:server start:plugin",
+    "test": "yarn workspace jbrowse-plugin-apollo run test"
   },
   "devDependencies": {
     "@babel/eslint-parser": "^7.14.7",

packages/apollo-mst/package.json

@@ -5,7 +5,7 @@
     "build": "tsc"
   },
   "dependencies": {
-    "@jbrowse/core": "^2.0.1",
+    "@jbrowse/core": "^2.1.4",
     "mobx": "^6.6.1",
     "mobx-state-tree": "^5.1.5",
     "rxjs": "^6.0.0",

packages/apollo-shared/package.json

@@ -8,7 +8,7 @@
   },
   "dependencies": {
     "@gmod/gff": "^1.2.0",
-    "@jbrowse/core": "^2.0.1",
+    "@jbrowse/core": "^2.1.4",
     "apollo-mst": "workspace:^",
     "apollo-schemas": "workspace:^",
     "bson-objectid": "^2.0.3",

packages/jbrowse-plugin-apollo/jest.config.js

@@ -0,0 +1,8 @@
+/** @type {import('ts-jest/dist/types').InitialOptionsTsJest} */
+module.exports = {
+  preset: 'ts-jest',
+  testEnvironment: 'node',
+  testPathIgnorePatterns: ['<rootDir>/cypress/'],
+  automock: false,
+  setupFiles: ['./jestSetup.js'],
+}

packages/jbrowse-plugin-apollo/jestSetup.js

@@ -0,0 +1,2 @@
+/* eslint-disable @typescript-eslint/no-var-requires */
+require('jest-fetch-mock').enableMocks()

packages/jbrowse-plugin-apollo/package.json

@@ -42,11 +42,6 @@
   "jbrowse-plugin": {
     "name": "Apollo"
   },
-  "jest": {
-    "testPathIgnorePatterns": [
-      "<rootDir>/cypress/"
-    ]
-  },
   "dependencies": {
     "@emotion/react": "^11.9.3",
     "@emotion/styled": "^11.9.3",
@@ -60,35 +55,46 @@
     "tslib": "^2.0.3"
   },
   "peerDependencies": {
-    "@jbrowse/core": "^2.0.1",
+    "@jbrowse/core": "^2.1.4",
     "@mui/material": "^5.9.1",
     "mobx": "^6.6.1",
     "mobx-react": "^7.2.1",
     "mobx-state-tree": "^5.1.5",
-    "react": "^17.0.2",
+    "prop-types": "^15.8.1",
+    "react": "^18.2.0",
+    "react-dom": "^18.2.0",
+    "rxjs": "^6.5.2",
     "tss-react": "^3.7.1"
   },
   "devDependencies": {
     "@jbrowse/cli": "^2.0.1",
-    "@jbrowse/core": "^2.0.1",
+    "@jbrowse/core": "^2.1.4",
     "@jbrowse/development-tools": "^2.1.1",
+    "@jest/globals": "^29.0.3",
     "@mui/material": "^5.9.1",
     "@mui/x-data-grid": "^5.12.3",
     "@types/cypress": "^1.1.3",
     "@types/node": "^16.11.6",
+    "@types/prop-types": "^15",
     "@types/react": "^17.0.34",
+    "@types/react-dom": "^18",
     "cypress": "^8.7.0",
-    "jest": "^27.3.1",
+    "jest": "^29.0.3",
+    "jest-fetch-mock": "^3.0.3",
     "mobx": "^6.6.1",
     "mobx-react": "^7.2.1",
     "mobx-state-tree": "^5.1.5",
     "npm-run-all": "4.1.5",
-    "react": "^17.0.2",
+    "prop-types": "^15.8.1",
+    "react": "^18.2.0",
+    "react-dom": "^18.2.0",
     "rimraf": "^3.0.2",
     "rollup": "^2.59.0",
+    "rxjs": "^6.5.2",
     "serve": "^14.0.1",
     "shx": "^0.3.3",
     "start-server-and-test": "^1.11.7",
+    "ts-jest": "^29.0.0",
     "ts-node": "^10.3.0",
     "tss-react": "^3.7.1",
     "typescript": "^4.7.4"

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/ApolloSequenceAdapter.test.ts

@@ -0,0 +1,66 @@
+import { beforeAll, beforeEach, describe, expect, it } from '@jest/globals'
+import fetchMock from 'jest-fetch-mock'
+import { toArray } from 'rxjs/operators'
+
+import { ApolloSequenceAdapter, RefSeq } from './ApolloSequenceAdapter'
+import configSchema from './configSchema'
+
+const mockRefSeqs: RefSeq[] = [
+  {
+    _id: '6317dac51a89f156b2e21a70',
+    name: 'ctgA',
+    description: 'the first contig',
+    length: 10000,
+  },
+  {
+    _id: '6317dac51a89f156b2e21b7c',
+    name: 'ctgB',
+    description: 'the second contig',
+    length: 10000,
+  },
+]
+
+describe('ApolloSequenceAdapter', () => {
+  let adapter: ApolloSequenceAdapter
+  beforeAll(async () => {
+    adapter = new ApolloSequenceAdapter(
+      configSchema.create({
+        assemblyId: '6317d5436061de774b43e9d6',
+        baseURL: 'http://fake.url',
+      }),
+    )
+    // populate refSeqs cache before the tests are run
+    fetchMock.mockResponseOnce(JSON.stringify(mockRefSeqs))
+    await adapter.getRefNames({})
+  })
+  beforeEach(() => {
+    fetchMock.resetMocks()
+  })
+  it('can get refNames and regions', async () => {
+    const refNames = await adapter.getRefNames({})
+    expect(refNames).toEqual(mockRefSeqs.map((r) => r.name))
+    const regions = await adapter.getRegions({})
+    expect(regions).toEqual(
+      mockRefSeqs.map((r) => ({ refName: r.name, start: 0, end: r.length })),
+    )
+  })
+  it('can get features', async () => {
+    fetchMock.mockResponseOnce('GCGTGCAACAGACTTTCCATGATGCGAGCT')
+    const features = adapter.getFeatures(
+      { refName: 'ctgA', start: 0, end: 30 },
+      {},
+    )
+    const featuresArray = await features.pipe(toArray()).toPromise()
+    expect(featuresArray).toMatchInlineSnapshot(`
+      [
+        {
+          "end": 30,
+          "refName": "ctgA",
+          "seq": "GCGTGCAACAGACTTTCCATGATGCGAGCT",
+          "start": 0,
+          "uniqueId": "ctgA 0-30",
+        },
+      ]
+    `)
+  })
+})

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/ApolloSequenceAdapter.ts

@@ -0,0 +1,133 @@
+import { readConfObject } from '@jbrowse/core/configuration'
+import {
+  BaseOptions,
+  BaseSequenceAdapter,
+} from '@jbrowse/core/data_adapters/BaseAdapter'
+import { getFetcher } from '@jbrowse/core/util/io'
+import { ObservableCreate } from '@jbrowse/core/util/rxjs'
+import SimpleFeature, { Feature } from '@jbrowse/core/util/simpleFeature'
+import { NoAssemblyRegion } from '@jbrowse/core/util/types'
+
+export interface RefSeq {
+  _id: string
+  name: string
+  description: string
+  length: number
+}
+
+export class ApolloSequenceAdapter extends BaseSequenceAdapter {
+  private refSeqs: Promise<RefSeq[]> | undefined
+
+  get baseURL() {
+    return readConfObject(this.config, 'baseURL')
+  }
+
+  protected async getRefSeqs({ signal }: BaseOptions) {
+    if (this.refSeqs) {
+      return this.refSeqs
+    }
+    const assemblyId = readConfObject(this.config, 'assemblyId')
+    const searchParams = new URLSearchParams({ assembly: assemblyId })
+    const uri = new URL(`refSeqs?${searchParams.toString()}`, this.baseURL).href
+    const fetch = getFetcher(
+      { locationType: 'UriLocation', uri },
+      this.pluginManager,
+    )
+    const response = await fetch(uri, { signal })
+    if (!response.ok) {
+      let errorMessage
+      try {
+        errorMessage = await response.text()
+      } catch (e) {
+        errorMessage = ''
+      }
+      throw new Error(
+        `Failed to fetch refSeqs — ${response.status} (${response.statusText})${
+          errorMessage ? ` (${errorMessage})` : ''
+        }`,
+      )
+    }
+    const refSeqs = (await response.json()) as RefSeq[]
+    this.refSeqs = Promise.resolve(refSeqs)
+    return refSeqs
+  }
+
+  public async getRefNames(opts: BaseOptions) {
+    const refSeqs = await this.getRefSeqs(opts)
+    return refSeqs.map((refSeq) => refSeq.name)
+  }
+
+  public async getRegions(opts: BaseOptions): Promise<NoAssemblyRegion[]> {
+    const refSeqs = await this.getRefSeqs(opts)
+    return refSeqs.map((refSeq) => ({
+      refName: refSeq.name,
+      start: 0,
+      end: refSeq.length,
+    }))
+  }
+
+  /**
+   * Fetch features for a certain region
+   * @param param -
+   * @returns Observable of Feature objects in the region
+   */
+  public getFeatures(
+    { refName, start, end }: NoAssemblyRegion,
+    opts: BaseOptions,
+  ) {
+    return ObservableCreate<Feature>(async (observer) => {
+      const refSeqs = await this.getRefSeqs(opts)
+      const refSeq = refSeqs.find((rs) => rs.name === refName)
+      if (!refSeq) {
+        return observer.error(
+          `Could not find refSeq that matched refName "${refName}"`,
+        )
+      }
+      const searchParams = new URLSearchParams({
+        refSeq: refSeq._id,
+        start: String(start),
+        end: String(end),
+      })
+      const uri = new URL(
+        `refSeqs/getSequence?${searchParams.toString()}`,
+        this.baseURL,
+      ).href
+      const fetch = getFetcher(
+        { locationType: 'UriLocation', uri },
+        this.pluginManager,
+      )
+      const response = await fetch(uri, { signal: opts.signal })
+      if (!response.ok) {
+        let errorMessage
+        try {
+          errorMessage = await response.text()
+        } catch (e) {
+          errorMessage = ''
+        }
+        throw new Error(
+          `Failed to fetch refSeqs — ${response.status} (${
+            response.statusText
+          })${errorMessage ? ` (${errorMessage})` : ''}`,
+        )
+      }
+      const seq = (await response.text()) as string
+      if (seq) {
+        observer.next(
+          new SimpleFeature({
+            id: `${refName} ${start}-${end}`,
+            data: { refName, start, end, seq },
+          }),
+        )
+      }
+      observer.complete()
+    })
+  }
+
+  /**
+   * called to provide a hint that data tied to a certain region
+   * will not be needed for the forseeable future and can be purged
+   * from caches, etc
+   */
+  // eslint-disable-next-line @typescript-eslint/no-empty-function
+  public freeResources(/* { region } */): void {}
+}

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/configSchema.ts

@@ -0,0 +1,16 @@
+import { ConfigurationSchema } from '@jbrowse/core/configuration'
+
+export default ConfigurationSchema(
+  'ApolloSequenceAdapter',
+  {
+    assemblyId: {
+      type: 'string',
+      defaultValue: '',
+    },
+    baseURL: {
+      type: 'string',
+      defaultValue: '',
+    },
+  },
+  { explicitlyTyped: true },
+)

packages/jbrowse-plugin-apollo/src/ApolloSequenceAdapter/index.ts

@@ -0,0 +1,22 @@
+import AdapterType from '@jbrowse/core/pluggableElementTypes/AdapterType'
+import PluginManager from '@jbrowse/core/PluginManager'
+
+import { ApolloSequenceAdapter } from './ApolloSequenceAdapter'
+import configSchema from './configSchema'
+
+export function installApolloSequenceAdapter(pluginManager: PluginManager) {
+  pluginManager.addAdapterType(
+    () =>
+      new AdapterType({
+        name: 'ApolloSequenceAdapter',
+        configSchema,
+        adapterMetadata: {
+          category: null,
+          hiddenFromGUI: true,
+          displayName: null,
+          description: null,
+        },
+        AdapterClass: ApolloSequenceAdapter,
+      }),
+  )
+}

packages/jbrowse-plugin-apollo/src/index.ts

@@ -21,6 +21,7 @@ import {
   ReactComponent as ApolloRendererReactComponent,
   configSchema as apolloRendererConfigSchema,
 } from './ApolloRenderer'
+import { installApolloSequenceAdapter } from './ApolloSequenceAdapter'
 import { AddAssembly, ImportFeatures, ViewChangeLog } from './components'
 import { DownloadGFF3 } from './components/DownloadGFF3'
 import {
@@ -39,6 +40,7 @@ export default class ApolloPlugin extends Plugin {
   version = version
 
   install(pluginManager: PluginManager) {
+    installApolloSequenceAdapter(pluginManager)
     pluginManager.addTrackType(() => {
       const configSchema = ConfigurationSchema(
         'ApolloTrack',