Improve support for MM .? modifiers.

htslib/sam.h

@@ -2271,6 +2271,44 @@ int bam_mods_at_qpos(const bam1_t *b, int qpos, hts_base_mod_state *state,
                      hts_base_mod *mods, int n_mods);
 
 
+/// Returns data about a specific modification type for the alignment record.
+/**
+ * @param b          BAM alignment record
+ * @param state      The base modification state pointer.
+ * @param code       Modification code.  If positive this is a character code,
+ *                   if negative it is a -ChEBI code.
+ *
+ * @param strand     Boolean for top (0) or bottom (1) strand
+ * @param implicit   Boolean for whether unlisted positions should be
+ *                   implicitly assumed to be unmodified, or require an
+ *                   explicit score and should be considered as unknown.
+ *                   Returned.
+ * @param canonical  Canonical base type associated with this modification
+ *                   Returned.
+ *
+ * @return 0 on success or -1 if not found.  The strand, implicit and canonical
+ * fields are filled out if passed in as non-NULL pointers.
+ */
+HTSLIB_EXPORT
+int bam_mods_query_type(hts_base_mod_state *state, int code,
+                        int *strand, int *implicit, char *canonical);
+
+/// Returns the list of base modification codes provided for this
+/// alignment record as an array of character codes (+ve) or ChEBI numbers
+/// (negative).
+/*
+ * @param b          BAM alignment record
+ * @param state      The base modification state pointer.
+ * @param ntype      Filled out with the number of array elements returned
+ *
+ * @return the type array, with *ntype filled out with the size.
+ *         The array returned should not be freed.
+ *         It is a valid pointer until the state is freed using
+ *         hts_base_mod_free().
+ */
+HTSLIB_EXPORT
+int *bam_mods_recorded(hts_base_mod_state *state, int *ntype);
+
 #ifdef __cplusplus
 }
 #endif

sam.c

@@ -6092,6 +6092,7 @@ struct hts_base_mod_state {
     char *MMend[MAX_BASE_MOD];  // end of pos-delta string
     uint8_t *ML[MAX_BASE_MOD];  // next qual
     int MLstride[MAX_BASE_MOD]; // bytes between quals for this type
+    int implicit[MAX_BASE_MOD]; // treat unlisted positions as non-modified?
     int seq_pos;                // current position along sequence
     int nmods;                  // used array size (0 to MAX_BASE_MOD-1).
 };
@@ -6160,6 +6161,7 @@ int bam_parse_basemod(const bam1_t *b, hts_base_mod_state *state) {
 
     char *cp = (char *)mm+1;
     int mod_num = 0;
+    int implicit = 1;
     while (*cp) {
         for (; *cp; cp++) {
             // cp should be [ACGTNU][+-]([a-zA-Z]+|[0-9]+)[.?]?(,\d+)*;
@@ -6192,16 +6194,15 @@ int bam_parse_basemod(const bam1_t *b, hts_base_mod_state *state) {
                 if (*cp == '\0')
                     return -1;
             }
+
             me = cp;
 
-            // Optional explicit vs implicit marker.
-            // Right now we ignore this field.  A proper API for
-            // querying it will follow later.
+            // Optional explicit vs implicit marker
             if (*cp == '.') {
-                // implicit = 1;
+                // default is implicit = 1;
                 cp++;
             } else if (*cp == '?') {
-                // implicit = 0;
+                implicit = 0;
                 cp++;
             } else if (*cp != ',' && *cp != ';') {
                 // parse error
@@ -6257,6 +6258,7 @@ int bam_parse_basemod(const bam1_t *b, hts_base_mod_state *state) {
                 state->strand   [mod_num] = (strand == '-');
                 state->canonical[mod_num] = btype;
                 state->MLstride [mod_num] = stride;
+                state->implicit [mod_num] = implicit;
 
                 state->MMcount  [mod_num] = delta;
                 if (b->core.flag & BAM_FREVERSE) {
@@ -6473,3 +6475,44 @@ int bam_mods_at_qpos(const bam1_t *b, int qpos, hts_base_mod_state *state,
 
     return r;
 }
+
+/*
+ * Returns the list of base modification codes provided for this
+ * alignment record as an array of character codes (+ve) or ChEBI numbers
+ * (negative).
+ *
+ * Returns the array, with *ntype filled out with the size.
+ *         The array returned should not be freed.
+ *         It is a valid pointer until the state is freed using
+ *         hts_base_mod_free().
+ */
+int *bam_mods_recorded(hts_base_mod_state *state, int *ntype) {
+    *ntype = state->nmods;
+    return state->type;
+}
+
+/*
+ * Returns data about a specific modification type for the alignment record.
+ * Code is either positive (eg 'm') or negative for ChEBI numbers.
+ *
+ * Return 0 on success or -1 if not found.  The strand, implicit and canonical
+ * fields are filled out if passed in as non-NULL pointers.
+ */
+int bam_mods_query_type(hts_base_mod_state *state, int code,
+                        int *strand, int *implicit, char *canonical) {
+    // Find code entry
+    int i;
+    for (i = 0; i < state->nmods; i++) {
+        if (state->type[i] == code)
+            break;
+    }
+    if (i == state->nmods)
+        return -1;
+
+    // Return data
+    if (strand)    *strand    = state->strand[i];
+    if (implicit)  *implicit  = state->implicit[i];
+    if (canonical) *canonical = "?AC?G???T??????N"[state->canonical[i]];
+
+    return 0;
+}

test/base_mods/MM-chebi.out

@@ -35,6 +35,7 @@
 34	C	C+m204 C+(76792)33 
 35	A	
 ---
+Present: m #-76792 n
 6	C	C+m102 
 15	N	N+n212 
 17	C	C+m128 

test/base_mods/MM-double.out

@@ -35,6 +35,7 @@
 34	A	
 35	T	
 ---
+Present: m m o
 1	G	G-m115 
 7	C	C+m128 
 12	G	G-m141 

test/base_mods/MM-explicit-x.out

@@ -0,0 +1,103 @@
+0	A	
+1	T	
+2	C	
+3	A	
+4	T	
+5	C	
+6	A	
+7	T	
+8	T	
+9	C	C+m.200 C+h.10 
+10	C	C+m.50 C+h.170 
+11	T	
+12	A	
+13	C	
+14	C	C+m.160 C+h.20 
+15	G	
+16	C	
+17	T	
+18	A	
+19	T	
+20	A	
+21	G	
+22	C	
+23	C	
+24	T	
+---
+Present: m h
+9	C	C+m200 C+h10 
+10	C	C+m50 C+h170 
+14	C	C+m160 C+h20 
+
+===
+
+0	A	
+1	T	
+2	C	
+3	A	
+4	T	
+5	C	
+6	A	
+7	T	
+8	T	
+9	C	C+m?200 C+h?10 
+10	C	C+m?50 C+h?170 
+11	T	
+12	A	
+13	C	C+m?10 C+h?5 
+14	C	C+m?160 C+h?20 
+15	G	
+16	C	C+m?10 C+h?5 
+17	T	
+18	A	
+19	T	
+20	A	
+21	G	
+22	C	
+23	C	
+24	T	
+---
+Present: m h
+9	C	C+m200 C+h10 
+10	C	C+m50 C+h170 
+13	C	C+m10 C+h5 
+14	C	C+m160 C+h20 
+16	C	C+m10 C+h5 
+
+===
+
+0	A	
+1	T	
+2	C	
+3	A	
+4	T	
+5	C	
+6	A	
+7	T	
+8	T	
+9	C	C+m.200 C+h?10 
+10	C	C+h?170 
+11	T	
+12	A	
+13	C	C+h?5 
+14	C	C+m.160 C+h?20 
+15	G	
+16	C	C+h?5 
+17	T	
+18	A	
+19	T	
+20	A	
+21	G	
+22	C	
+23	C	
+24	T	
+---
+Present: m h
+9	C	C+m200 C+h10 
+10	C	C+h170 
+13	C	C+h5 
+14	C	C+m160 C+h20 
+16	C	C+h5 
+
+===
+

test/base_mods/MM-explicit.out

@@ -24,6 +24,7 @@
 23	C	
 24	T	
 ---
+Present: m h
 9	C	C+m200 C+h10 
 10	C	C+m50 C+h170 
 14	C	C+m160 C+h20 
@@ -56,6 +57,7 @@
 23	C	
 24	T	
 ---
+Present: m h
 9	C	C+m200 C+h10 
 10	C	C+m50 C+h170 
 13	C	C+m10 C+h5 
@@ -90,6 +92,7 @@
 23	C	
 24	T	
 ---
+Present: m h
 9	C	C+m200 C+h10 
 10	C	C+h170 
 13	C	C+h5 

test/base_mods/MM-explicit.sam

@@ -4,10 +4,24 @@
 @CO	unchecked and require an explicit statement to indicate it was
 @CO	looked at and no base modification was observed.
 @CO	
-@CO	  0  1   23  45 6     78
-@CO	ATCATCATTCCTACCGCTATAGCCT
-@CO	  .  .   m.  .m .     ..  m
-@CO	  ?  ?   .h  .. .     ??  h
+@CO	ATCATCATTCCTACCGCTATAGCCT  r1; implicit
+@CO	  -  -   ..  -. -     --
+@CO	         Mm   M
+@CO	  -  -   ..  -. -     --
+@CO	         hH   h
+@CO	
+@CO	ATCATCATTCCTACCGCTATAGCCT  r2; explicit to a small region
+@CO	  -  -   ??  ?? ?     --
+@CO	         Mm  mM m
+@CO	  -  -   ??  ?? ?     --
+@CO	         hH  hh h
+@CO	
+@CO	ATCATCATTCCTACCGCTATAGCCT  r3; mixture
+@CO	  -  -   .   -. -     --
+@CO	         M    M
+@CO       -  -   ??  ?? ?     --
+@CO	         hH  hh h     --
+@CO	
 r1	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	Mm:Z:C+mh,2,0,1;	Ml:B:C,200,10,50,170,160,20
 r2	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	Mm:Z:C+mh?,2,0,0,0,0;	Ml:B:C,200,10,50,170,10,5,160,20,10,5
 r3	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	Mm:Z:C+m.,2,2;C+h?,2,0,0,0,0;	Ml:B:C,200,160,10,170,5,20,5

test/base_mods/MM-multi.out

@@ -35,6 +35,7 @@
 34	C	C+m230 C+h6 
 35	A	
 ---
+Present: m h n
 6	C	C+m128 
 15	N	N+n215 
 17	C	C+m153 
@@ -83,6 +84,7 @@
 34	C	C+m204 C+h31 
 35	A	
 ---
+Present: m h n
 6	C	C+m77 C+h159 
 15	N	N+n240 
 17	C	C+m103 C+h133 

test/base_mods/base-mods.tst

@@ -33,10 +33,11 @@
 # samtools binary. This can be useful for testing older versions.
 
 # Test files from SAM spec
-P MM-chebi.out     $test_mod MM-chebi.sam
-P MM-double.out    $test_mod MM-double.sam
-P MM-multi.out     $test_mod MM-multi.sam
-P MM-explicit.out  $test_mod MM-explicit.sam
+P MM-chebi.out       $test_mod    MM-chebi.sam
+P MM-double.out      $test_mod    MM-double.sam
+P MM-multi.out       $test_mod    MM-multi.sam
+P MM-explicit.out    $test_mod    MM-explicit.sam
+P MM-explicit-x.out  $test_mod -x MM-explicit.sam
 
 # Pileup testing
 P MM-pileup.out $pileup_mod < MM-pileup.sam