Merge pull request #180 from nf-core/lsp-formatting

Run lsp formatting
nf-core · Dec 22, 2024 · ae6518e · ae6518e
2 parents 7a4e356 + e6b3ecd
commit ae6518e
Show file tree

Hide file tree

Showing 39 changed files with 431 additions and 416 deletions.
diff --git a/conf/test.config b/conf/test.config
@@ -24,30 +24,30 @@ params {
 
     // Input data
     // TODO params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv'
-    input = "${projectDir}/assets/samplesheet.csv"
+    input                      = "${projectDir}/assets/samplesheet.csv"
 
     // Genome references
-    fasta = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21.fa'
-    gtf = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/genes_chr21.gtf'
-    hisat2_index = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21_hisat2.tar.gz'
+    fasta                      = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21.fa'
+    gtf                        = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/genes_chr21.gtf'
+    hisat2_index               = 'https://raw.githubusercontent.com/nf-core/test-datasets/nascent/reference/GRCh38_chr21_hisat2.tar.gz'
 
-    assay_type = "GROseq"
-    skip_grohmm = true // FIXME Fails due to higher memory requirements
+    assay_type                 = "GROseq"
+    // FIXME Fails due to higher memory requirements
+    skip_grohmm                = true
     grohmm_min_uts             = 5
     grohmm_max_uts             = 10
     grohmm_min_ltprobb         = -100
     grohmm_max_ltprobb         = -150
-    filter_bed = "${projectDir}/tests/config/unwanted_region.bed"
-    intersect_bed = "${projectDir}/tests/config/wanted_region.bed"
+    filter_bed                 = "${projectDir}/tests/config/unwanted_region.bed"
+    intersect_bed              = "${projectDir}/tests/config/wanted_region.bed"
 }
 
 process {
     withName: STAR_GENOMEGENERATE {
         ext.args = '--genomeSAindexNbases 9'
     }
 
-    withName: 'PINTS_CALLER' {
-        // HACK Tests fail after latest modules update
+    withName: PINTS_CALLER {
         ext.args = { "--disable-small" }
     }
 }
diff --git a/conf/test_copro.config b/conf/test_copro.config
@@ -15,17 +15,17 @@ params {
     config_profile_description = 'Test dataset to check PINTS pipeline function(https://pints.yulab.org/tre_calling#part-iv-case-2)'
 
     // Input data
-    input = "${projectDir}/tests/config/samplesheets/copro.csv"
+    input                      = "${projectDir}/tests/config/samplesheets/copro.csv"
 
-    genome = 'hg38'
-    assay_type = 'CoPRO'
-    filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
-    with_umi = true
-    umitools_dedup_stats = true
+    genome                     = 'hg38'
+    assay_type                 = 'CoPRO'
+    filter_bed                 = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
+    with_umi                   = true
+    umitools_dedup_stats       = true
 }
 
 process {
-    withName: NFCORE_NASCENT:NASCENT:FASTP {
+    withName: FASTP {
         ext.args = [
             "--adapter_sequence TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC",
             "--adapter_sequence_r2 GATCGTCGGACTGTAGAACTCTGAAC",

diff --git a/conf/test_full.config b/conf/test_full.config
@@ -16,9 +16,9 @@ params {
 
     // Input data for full size test
     // TODO params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_full_illumina_amplicon.csv'
-    input = "${projectDir}/assets/samplesheet_full.csv"
+    input                      = "${projectDir}/assets/samplesheet_full.csv"
 
     // Genome references
-    genome = 'hg38'
-    assay_type = 'GROseq'
+    genome                     = 'hg38'
+    assay_type                 = 'GROseq'
 }
diff --git a/conf/test_grocap.config b/conf/test_grocap.config
@@ -15,21 +15,22 @@ params {
     config_profile_description = 'Test dataset to check PINTS pipeline function(https://pints.yulab.org/tre_calling#part-iii-case-1)'
 
     // Input data
-    input = "${projectDir}/tests/config/samplesheets/grocap.csv"
+    input                      = "${projectDir}/tests/config/samplesheets/grocap.csv"
 
-    genome = 'hg38'
-    assay_type = 'GROcap'
-    filter_bed = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
+    genome                     = 'hg38'
+    assay_type                 = 'GROcap'
+    filter_bed                 = "https://pints.yulab.org/ref/examples/promoters_1kb_tss_centered.bed.gz"
 }
 
 process {
-    withName: NFCORE_NASCENT:NASCENT:FASTP {
+    // only keep reads longer than 14nts after trimming
+    // This library was polyadenylated,
+    // so we are trimming the last 20nts per reads (with --trim_tail1).
+    // For more recent single-end PRO/GRO-cap libraries, this may not be necessary.
+    withName: 'NFCORE_NASCENT:NASCENT:FASTP' {
         ext.args = [
             "--adapter_sequence TGGAATTCTCGGGTGCCAAGG",
-            "-l 14", // only keep reads longer than 14nts after trimming
-            // This library was polyadenylated,
-            // so we are trimming the last 20nts per reads (with --trim_tail1).
-            // For more recent single-end PRO/GRO-cap libraries, this may not be necessary.
+            "-l 14",
             "--trim_tail1 20",
             "--low_complexity_filter",
             "-w 8"

diff --git a/modules/local/bed2saf.nf b/modules/local/bed2saf.nf
@@ -1,11 +1,11 @@
 process BED2SAF {
-    tag "$meta.id"
+    tag "${meta.id}"
     label 'process_single'
 
     conda "conda-forge::gawk=5.1.0"
-    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
-        'nf-core/ubuntu:20.04' }"
+    container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+        ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04'
+        : 'nf-core/ubuntu:20.04'}"
 
     input:
     tuple val(meta), path(bed)
@@ -20,7 +20,7 @@ process BED2SAF {
     script:
     """
     awk 'OFS="\\t" {print \$1"."\$2"."\$3, \$1, \$2, \$3, "."}' \\
-        $bed \\
+        ${bed} \\
         > ${bed.baseName}.saf
 
     cat <<-END_VERSIONS > versions.yml

diff --git a/modules/local/dreg_prep/main.nf b/modules/local/dreg_prep/main.nf
@@ -1,16 +1,16 @@
 process DREG_PREP {
 
-    tag "$meta.id"
+    tag "${meta.id}"
     label 'process_low'
 
     conda "${moduleDir}/environment.yml"
-    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0' :
-        'biocontainers/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0' }"
+    container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+        ? 'https://depot.galaxyproject.org/singularity/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0'
+        : 'biocontainers/mulled-v2-f01e242bdea19948f0576fdca94777242fe4c2cb:4238fb992d2a93e648108c86e3a9f51348e834a9-0'}"
 
     input:
     tuple val(meta), path(bam_file), val(index)
-    path  sizes
+    path sizes
     val assay_type
 
     output:
@@ -78,10 +78,11 @@ process DREG_PREP {
 
         echo "bedGraph to bigwig done"
         """
-    } else {
+    }
+    else {
         if (forwardStranded) {
             """
-            samtools view -@ $task.cpus -bf 0x2 ${bam_file} | samtools sort -n -@ $task.cpus \\
+            samtools view -@ ${task.cpus} -bf 0x2 ${bam_file} | samtools sort -n -@ ${task.cpus} \\
                 > ${prefix}.dreg.bam
 
             bedtools bamtobed -bedpe -mate1 -i ${prefix}.dreg.bam \\
@@ -118,9 +119,10 @@ process DREG_PREP {
                 ${prefix}.unsorted.bedGraph \\
                 > ${prefix}.bedGraph
             """
-        } else {
+        }
+        else {
             """
-            samtools view -@ $task.cpus -bf 0x2 ${bam_file} | samtools sort -n -@ $task.cpus \\
+            samtools view -@ ${task.cpus} -bf 0x2 ${bam_file} | samtools sort -n -@ ${task.cpus} \\
                 > ${prefix}.dreg.bam
 
             bedtools bamtobed -bedpe -mate1 -i ${prefix}.dreg.bam \\

diff --git a/modules/local/grohmm/parametertuning/main.nf b/modules/local/grohmm/parametertuning/main.nf
@@ -1,12 +1,12 @@
 process GROHMM_PARAMETERTUNING {
-    tag "$meta.id|$UTS|$LtProbB"
+    tag "${meta.id}|${UTS}|${LtProbB}"
     label 'process_high'
     // array 10
 
     conda "${moduleDir}/environment.yml"
-    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data' :
-        'community.wave.seqera.io/library/grohmm:833aa94cad4202ac' }"
+    container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+        ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data'
+        : 'community.wave.seqera.io/library/grohmm:833aa94cad4202ac'}"
 
     input:
     tuple val(meta), path(bams), path(bais), val(UTS), val(LtProbB)
@@ -15,7 +15,7 @@ process GROHMM_PARAMETERTUNING {
     output:
     tuple val(meta), path("*.tuning.csv"), emit: tuning
     tuple val(meta), path("*.tuning.consensus.bed"), emit: bed
-    path  "versions.yml", emit: versions
+    path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -27,12 +27,12 @@ process GROHMM_PARAMETERTUNING {
     grohmm_parametertuning.R \\
         --bam_file ${bams} \\
         --outprefix ${prefix} \\
-        --gxf $gxf \\
-        --uts $UTS \\
-        --ltprobb $LtProbB \\
+        --gxf ${gxf} \\
+        --uts ${UTS} \\
+        --ltprobb ${LtProbB} \\
         --outdir ./ \\
-        --cores $task.cpus \\
-        $args
+        --cores ${task.cpus} \\
+        ${args}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

diff --git a/modules/local/grohmm/transcriptcalling/main.nf b/modules/local/grohmm/transcriptcalling/main.nf
@@ -1,25 +1,25 @@
 process GROHMM_TRANSCRIPTCALLING {
-    tag "$meta.id"
+    tag "${meta.id}"
     label 'process_high'
     label 'process_long'
 
     conda "${moduleDir}/environment.yml"
-    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data' :
-        'community.wave.seqera.io/library/grohmm:833aa94cad4202ac' }"
+    container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+        ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b9/b929af5662486ba6ce2d27eb501e5c7ec71ca7dd8e333fe5d3dcf2803d87cf67/data'
+        : 'community.wave.seqera.io/library/grohmm:833aa94cad4202ac'}"
 
     input:
     tuple val(meta), path(bams), path(bais), path(tuning_file)
     path gxf
 
     output:
     tuple val(meta), path("*.transcripts.txt"), emit: transcripts
-    tuple val(meta), path("*.eval.txt")       , emit: eval
+    tuple val(meta), path("*.eval.txt"), emit: eval
     tuple val(meta), path("*.transcripts.bed"), emit: transcripts_bed
-    tuple val(meta), path("*.tdFinal.txt")    , emit: td
-    tuple val(meta), path("*.tdplot_mqc.png") , emit: td_plot
-    tuple val(meta), path("*.tdFinal_mqc.csv") , emit: mqc_csv
-    path  "versions.yml"     , emit: versions
+    tuple val(meta), path("*.tdFinal.txt"), emit: td
+    tuple val(meta), path("*.tdplot_mqc.png"), emit: td_plot
+    tuple val(meta), path("*.tdFinal_mqc.csv"), emit: mqc_csv
+    path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
@@ -32,11 +32,11 @@ process GROHMM_TRANSCRIPTCALLING {
         --bam_file ${bams} \\
         --tuning_file ${tuning_file} \\
         --outprefix ${prefix} \\
-        --gxf $gxf \\
+        --gxf ${gxf} \\
         --outdir ./ \\
-        --cores $task.cpus \\
+        --cores ${task.cpus} \\
         --memory ${task.memory.toMega()} \\
-        $args
+        ${args}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

diff --git a/modules/local/gtf2bed.nf b/modules/local/gtf2bed.nf
@@ -1,26 +1,27 @@
 process GTF2BED {
-    tag "$gtf"
+    tag "${gtf}"
     label 'process_low'
 
     conda "conda-forge::perl=5.26.2"
-    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/perl:5.26.2' :
-        'biocontainers/perl:5.26.2' }"
+    container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
+        ? 'https://depot.galaxyproject.org/singularity/perl:5.26.2'
+        : 'biocontainers/perl:5.26.2'}"
 
     input:
     path gtf
 
     output:
-    path '*.bed'       , emit: bed
+    path '*.bed', emit: bed
     path "versions.yml", emit: versions
 
     when:
     task.ext.when == null || task.ext.when
 
-    script: // This script is bundled with the pipeline, in nf-core/nascent/bin/
+    script:
+    // This script is bundled with the pipeline, in nf-core/nascent/bin/
     """
     gtf2bed \\
-        $gtf \\
+        ${gtf} \\
         > ${gtf.baseName}.bed
 
     cat <<-END_VERSIONS > versions.yml

diff --git a/subworkflows/local/align_bwamem2/main.nf b/subworkflows/local/align_bwamem2/main.nf
@@ -2,15 +2,15 @@
 // Alignment with BWAMEM2
 //
 
-include { BWAMEM2_MEM       } from '../../../modules/nf-core/bwamem2/mem/main'
+include { BWAMEM2_MEM             } from '../../../modules/nf-core/bwamem2/mem/main'
 include { BAM_SORT_STATS_SAMTOOLS } from '../../nf-core/bam_sort_stats_samtools/main'
 
 workflow ALIGN_BWAMEM2 {
     take:
-    ch_reads        // channel (mandatory): [ val(meta), [ path(reads) ] ]
-    ch_index        // channel (mandatory): [ val(meta2), path(index) ]
-    val_sort_bam    // boolean (mandatory): true or false
-    ch_fasta        // channel (optional) : [ val(meta3), path(fasta) ]
+    ch_reads     // channel (mandatory): [ val(meta), [ path(reads) ] ]
+    ch_index     // channel (mandatory): [ val(meta2), path(index) ]
+    val_sort_bam // boolean (mandatory): true or false
+    ch_fasta     // channel (optional) : [ val(meta3), path(fasta) ]
 
     main:
     ch_versions = Channel.empty()
@@ -19,25 +19,23 @@ workflow ALIGN_BWAMEM2 {
     // Map reads with BWA
     //
 
-    BWAMEM2_MEM ( ch_reads, ch_index, ch_fasta, val_sort_bam )
+    BWAMEM2_MEM(ch_reads, ch_index, ch_fasta, val_sort_bam)
     ch_versions = ch_versions.mix(BWAMEM2_MEM.out.versions.first())
 
     //
     // Sort, index BAM file and run samtools stats, flagstat and idxstats
     //
 
-    BAM_SORT_STATS_SAMTOOLS ( BWAMEM2_MEM.out.bam, ch_fasta )
+    BAM_SORT_STATS_SAMTOOLS(BWAMEM2_MEM.out.bam, ch_fasta)
     ch_versions = ch_versions.mix(BAM_SORT_STATS_SAMTOOLS.out.versions)
 
     emit:
-    bam_orig = BWAMEM2_MEM.out.bam                  // channel: [ val(meta), path(bam) ]
-
-    bam      = BAM_SORT_STATS_SAMTOOLS.out.bam      // channel: [ val(meta), path(bam) ]
-    bai      = BAM_SORT_STATS_SAMTOOLS.out.bai      // channel: [ val(meta), path(bai) ]
-    csi      = BAM_SORT_STATS_SAMTOOLS.out.csi      // channel: [ val(meta), path(csi) ]
-    stats    = BAM_SORT_STATS_SAMTOOLS.out.stats    // channel: [ val(meta), path(stats) ]
+    bam_orig = BWAMEM2_MEM.out.bam // channel: [ val(meta), path(bam) ]
+    bam      = BAM_SORT_STATS_SAMTOOLS.out.bam // channel: [ val(meta), path(bam) ]
+    bai      = BAM_SORT_STATS_SAMTOOLS.out.bai // channel: [ val(meta), path(bai) ]
+    csi      = BAM_SORT_STATS_SAMTOOLS.out.csi // channel: [ val(meta), path(csi) ]
+    stats    = BAM_SORT_STATS_SAMTOOLS.out.stats // channel: [ val(meta), path(stats) ]
     flagstat = BAM_SORT_STATS_SAMTOOLS.out.flagstat // channel: [ val(meta), path(flagstat) ]
     idxstats = BAM_SORT_STATS_SAMTOOLS.out.idxstats // channel: [ val(meta), path(idxstats) ]
-
-    versions = ch_versions                          // channel: [ path(versions.yml) ]
+    versions = ch_versions // channel: [ path(versions.yml) ]
 }