Added --stable-rogues to shuffle sites

align/align.go

@@ -50,7 +50,7 @@ type Alignment interface {
 	Length() int
 	Mutate(rate float64) // Adds uniform substitutions in the alignment (~sequencing errors)
 	ShuffleSequences()
-	ShuffleSites(rate float64, roguerate float64) []string
+	ShuffleSites(rate float64, roguerate float64, randroguefirst bool) []string
 	SimulateRogue(prop float64, proplen float64) ([]string, []string)
 	Sort()                         // Sorts the alignment by sequence name
 	RemoveGapSites(cutoff float64) // Removes sites having >= cutoff gaps
@@ -255,8 +255,13 @@ func (a *align) ShuffleSequences() {
 // rate must be >=0 and <=1
 // Then, take roguerate proportion of the taxa, and will shuffle rate sites among the
 // remaining intact sites
+// randroguefirst: If true, then with a given seed, rogues will always be the same with all alignments
+// having sequences in the same order. It may not be the case if false, especially when alignemnts
+// have different lengths.
 // Output: List of tax names that are more shuffled than others (length=roguerate*nbsequences)
-func (a *align) ShuffleSites(rate float64, roguerate float64) []string {
+func (a *align) ShuffleSites(rate float64, roguerate float64, randroguefirst bool) []string {
+	var sitepermutation, taxpermutation []int
+
 	if rate < 0 || rate > 1 {
 		io.ExitWithMessage(errors.New("Shuffle site rate must be >=0 and <=1"))
 	}
@@ -267,8 +272,14 @@ func (a *align) ShuffleSites(rate float64, roguerate float64) []string {
 	nb_sites_to_shuffle := int(rate * float64(a.Length()))
 	nb_rogue_sites_to_shuffle := int(rate * (1.0 - rate) * (float64(a.Length())))
 	nb_rogue_seq_to_shuffle := int(roguerate * float64(a.NbSequences()))
-	sitepermutation := rand.Perm(a.Length())
-	taxpermutation := rand.Perm(a.NbSequences())
+	if randroguefirst {
+		taxpermutation = rand.Perm(a.NbSequences())
+		sitepermutation = rand.Perm(a.Length())
+	} else {
+		sitepermutation = rand.Perm(a.Length())
+		taxpermutation = rand.Perm(a.NbSequences())
+	}
+
 	rogues := make([]string, nb_rogue_seq_to_shuffle)
 
 	if (nb_rogue_sites_to_shuffle + nb_sites_to_shuffle) > a.Length() {

cmd/sites.go

@@ -7,6 +7,7 @@ import (
 var siteRate float64
 var siteRogue float64
 var siteRogueNameFile string
+var stableRogues bool
 
 // sitesCmd represents the sites command
 var sitesCmd = &cobra.Command{
@@ -34,7 +35,7 @@ goalign shuffle sites -i align.fasta -r 0.5
 		f := openWriteFile(shuffleOutput)
 		nameFile := openWriteFile(siteRogueNameFile)
 		for al := range rootaligns {
-			names := al.ShuffleSites(siteRate, siteRogue)
+			names := al.ShuffleSites(siteRate, siteRogue, stableRogues)
 			writeAlign(al, f)
 			for _, n := range names {
 				nameFile.WriteString(n)
@@ -51,4 +52,5 @@ func init() {
 	sitesCmd.PersistentFlags().Float64VarP(&siteRate, "rate", "r", 0.5, "Rate of shuffled sites (>=0 and <=1)")
 	sitesCmd.PersistentFlags().Float64Var(&siteRogue, "rogue", 0.0, "If set, then will take the given proportion of taxa, and will apply shuffle again on --rate of the remaining intact sites")
 	sitesCmd.PersistentFlags().StringVar(&siteRogueNameFile, "rogue-file", "stdout", "Rogue sequence names output file")
+	sitesCmd.PersistentFlags().BoolVar(&stableRogues, "stable-rogues", false, "If true, then with a given seed, rogues will always be the same with all alignments having sequences in the same order. It may not be the case if false, especially when alignemnts have different lengths.")
 }

test.sh

@@ -836,6 +836,46 @@ diff result expected
 diff rogueexpected rogues.txt
 rm -f expected result rogueexpected rogues.txt
 
+echo "->goalign shuffle sites rogues stables"
+cat > expected <<EOF
+>Seq0000
+CATTTATTTGCGGACGTCGTGAAAGTGTAGTTCAAACACATCAAACTGGC
+>Seq0001
+CCTTATACCGGAGGATACAAATGGAATAATATTTAGATCTTCAGAAAGCC
+>Seq0002
+AGTCGCAGCTAAGTATGGGTGATCTCTCTGAATACTATCCGAGTCAAGGG
+>Seq0003
+CTATGTTTCCGCTGTCGGGGCTCGAGGTCTGTAGAAGGTTTGGCGATAGG
+>Seq0004
+ATGAGCGCGGGGTAAATGCCCTTTAGACGAAGTCAGCGATTCACCGTTTA
+>Seq0005
+GCGAGGATCCCCCTCGAAAAATATTAAGGATGTTATCACTATTGTTCATC
+>Seq0006
+GAATTGAAGCTGTTACGCTATACCGTGGTGGGAATAGAGGGTGACACCCT
+>Seq0007
+ATAGTAAGCAGTAAGGCTCGCGAATGCCTCAGGTACACTGCTGTCTTCGC
+>Seq0008
+CACAAGCCTTGCGTGGATCAGCCGGAGCACGGCTACTGCCACTGATCTCC
+>Seq0009
+TTTACTACTCCACGGCTACACGGACCTAGATGCTTGATTACTAGGTCTGG
+EOF
+
+cat > rogueexpected <<EOF
+Seq0001
+Seq0002
+Seq0008
+Seq0004
+Seq0006
+EOF
+
+goalign random -l 50 -s 10 | goalign shuffle sites -r 0.5 -s 10 --rogue 0.5 --rogue-file rogues.txt --stable-rogues  > result
+goalign random -l 30 -s 11 | goalign shuffle sites -r 0.5 -s 10 --rogue 0.5 --rogue-file rogues2.txt --stable-rogues  > /dev/null
+diff result expected
+diff rogueexpected rogues.txt
+# Should be the same list of rogues, even if random gen seed is
+# different and length is different (initial seq order is the same)
+diff rogues.txt rogues2.txt
+rm -f expected result rogueexpected rogues.txt
 
 echo "->goalign stats"
 cat > expected <<EOF