Add FragmentWithOverhangs (#387)

* Add FragmentWithOverhangs

* Fragment naming updated

---------

Co-authored-by: Tim <TimothyStiles@users.noreply.github.com>

CHANGELOG.md

@@ -11,6 +11,10 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 - Alternative start codons can now be used in the `synthesis/codon` DNA -> protein translation package (#305)
 - Added a parser and writer for the `pileup` sequence alignment format (#329)
 - Added statistics to the `synthesis/codon` package (keeping track of the observed start codon occurrences in a translation table) (#350)
+- Added option to fragmenter to fragment with only certain overhangs (#387)
+
+
+
 
 ### Fixed
 - `fastq` parser no longer becomes de-aligned when reading (#325)

synthesis/fragment/fragment.go

@@ -98,11 +98,11 @@ func NextOverhang(currentOverhangs []string) string {
 }
 
 // optimizeOverhangIteration takes in a sequence and optimally fragments it.
-func optimizeOverhangIteration(sequence string, minFragmentSize int, maxFragmentSize int, existingFragments []string, existingOverhangs []string) ([]string, float64, error) {
+func optimizeOverhangIteration(sequence string, minFragmentSize int, maxFragmentSize int, existingFragments []string, excludeOverhangs []string, includeOverhangs []string) ([]string, float64, error) {
 	// If the sequence is smaller than maxFragment size, stop iteration.
 	if len(sequence) < maxFragmentSize {
 		existingFragments = append(existingFragments, sequence)
-		return existingFragments, SetEfficiency(existingOverhangs), nil
+		return existingFragments, SetEfficiency(excludeOverhangs), nil
 	}
 
 	// Make sure minFragmentSize > maxFragmentSize
@@ -136,23 +136,35 @@ func optimizeOverhangIteration(sequence string, minFragmentSize int, maxFragment
 	var bestOverhangEfficiency float64
 	var bestOverhangPosition int
 	var alreadyExists bool
+	var buildAvailable bool
 	for overhangOffset := 0; overhangOffset <= maxFragmentSize-minFragmentSize; overhangOffset++ {
 		// We go from max -> min, so we can maximize the size of our fragments
 		overhangPosition := maxFragmentSize - overhangOffset
 		overhangToTest := sequence[overhangPosition-4 : overhangPosition]
 
 		// Make sure overhang isn't already in set
 		alreadyExists = false
-		for _, existingOverhang := range existingOverhangs {
-			if existingOverhang == overhangToTest || transform.ReverseComplement(existingOverhang) == overhangToTest {
+		for _, excludeOverhang := range excludeOverhangs {
+			if excludeOverhang == overhangToTest || transform.ReverseComplement(excludeOverhang) == overhangToTest {
 				alreadyExists = true
 			}
 		}
-		if !alreadyExists {
+		// Make sure overhang is in set of includeOverhangs. If includeOverhangs is
+		// blank, skip this check.
+		buildAvailable = false
+		if len(includeOverhangs) == 0 {
+			buildAvailable = true
+		}
+		for _, includeOverhang := range includeOverhangs {
+			if includeOverhang == overhangToTest || transform.ReverseComplement(includeOverhang) == overhangToTest {
+				buildAvailable = true
+			}
+		}
+		if !alreadyExists && buildAvailable {
 			// See if this overhang is a palindrome
 			if !checks.IsPalindromic(overhangToTest) {
 				// Get this overhang set's efficiency
-				setEfficiency := SetEfficiency(append(existingOverhangs, overhangToTest))
+				setEfficiency := SetEfficiency(append(excludeOverhangs, overhangToTest))
 
 				// If this overhang is more efficient than any other found so far, set it as the best!
 				if setEfficiency > bestOverhangEfficiency {
@@ -167,16 +179,24 @@ func optimizeOverhangIteration(sequence string, minFragmentSize int, maxFragment
 		return []string{}, float64(0), fmt.Errorf("bestOverhangPosition failed by equaling zero")
 	}
 	existingFragments = append(existingFragments, sequence[:bestOverhangPosition])
-	existingOverhangs = append(existingOverhangs, sequence[bestOverhangPosition-4:bestOverhangPosition])
+	excludeOverhangs = append(excludeOverhangs, sequence[bestOverhangPosition-4:bestOverhangPosition])
 	sequence = sequence[bestOverhangPosition-4:]
-	return optimizeOverhangIteration(sequence, minFragmentSize, maxFragmentSize, existingFragments, existingOverhangs)
+	return optimizeOverhangIteration(sequence, minFragmentSize, maxFragmentSize, existingFragments, excludeOverhangs, includeOverhangs)
 }
 
 // Fragment fragments a sequence into fragments between the min and max size,
 // choosing fragment ends for optimal assembly efficiency. Since fragments will
 // be inserted into either a vector or primer binding sites, the first 4 and
 // last 4 base pairs are the initial overhang set.
-func Fragment(sequence string, minFragmentSize int, maxFragmentSize int, existingOverhangs []string) ([]string, float64, error) {
+func Fragment(sequence string, minFragmentSize int, maxFragmentSize int, excludeOverhangs []string) ([]string, float64, error) {
+	sequence = strings.ToUpper(sequence)
+	return optimizeOverhangIteration(sequence, minFragmentSize, maxFragmentSize, []string{}, append([]string{sequence[:4], sequence[len(sequence)-4:]}, excludeOverhangs...), []string{})
+}
+
+// FragmentWithOverhangs fragments a sequence with only a certain overhang set.
+// This is useful if you are constraining the set of possible overhangs when
+// doing more advanced forms of cloning.
+func FragmentWithOverhangs(sequence string, minFragmentSize int, maxFragmentSize int, excludeOverhangs []string, includeOverhangs []string) ([]string, float64, error) {
 	sequence = strings.ToUpper(sequence)
-	return optimizeOverhangIteration(sequence, minFragmentSize, maxFragmentSize, []string{}, append([]string{sequence[:4], sequence[len(sequence)-4:]}, existingOverhangs...))
+	return optimizeOverhangIteration(sequence, minFragmentSize, maxFragmentSize, []string{}, append([]string{sequence[:4], sequence[len(sequence)-4:]}, excludeOverhangs...), includeOverhangs)
 }

synthesis/fragment/fragment_test.go

@@ -85,3 +85,13 @@ func TestRegressionTestMatching12(t *testing.T) {
 		t.Errorf("Expected efficiency of .99 - approximately matches NEB ligase fidelity viewer of .97. Got: %g", efficiency)
 	}
 }
+
+func TestFragmentWithOverhangs(t *testing.T) {
+	defaultOverhangs := []string{"CGAG", "GTCT", "GGGG", "AAAA", "AACT", "AATG", "ATCC", "CGCT", "TTCT", "AAGC", "ATAG", "ATTA", "ATGT", "ACTC", "ACGA", "TATC", "TAGG", "TACA", "TTAC", "TTGA", "TGGA", "GAAG", "GACC", "GCCG", "TCTG", "GTTG", "GTGC", "TGCC", "CTGG", "TAAA", "TGAG", "AAGA", "AGGT", "TTCG", "ACTA", "TTAG", "TCTC", "TCGG", "ATAA", "ATCA", "TTGC", "CACG", "AATA", "ACAA", "ATGG", "TATG", "AAAT", "TCAC"}
+	gene := "atgaaaaaatttaactggaagaaaatagtcgcgccaattgcaatgctaattattggcttactaggtggtttacttggtgcctttatcctactaacagcagccggggtatcttttaccaatacaacagatactggagtaaaaacggctaagaccgtctacaccaatataacagatacaactaaggctgttaagaaagtacaaaatgccgttgtttctgtcatcaattatcaagaaggttcatcttcagattctctaaatgacctttatggccgtatctttggcggaggggacagttctgattctagccaagaaaattcaaaagattcagatggtctacaggtcgctggtgaaggttctggagtcatctataaaaaagatggcaaagaagcctacatcgtaaccaataaccatgttgtcgatggggctaaaaaacttgaaatcatgctttcggatggttcgaaaattactggtgaacttgttggtaaagacacttactctgacctagcagttgtcaaagtatcttcagataaaataacaactgttgcagaatttgcagactcaaactcccttactgttggtgaaaaagcaattgctatcggtagcccacttggtaccgaatacgccaactcagtaacagaaggaatcgtttctagccttagccgtactataacgatgcaaaacgataatggtgaaactgtatcaacaaacgctatccaaacagatgcagccattaaccctggtaactctggtggtgccctagtcaatattgaaggacaagttatcggtattaattcaagtaaaatttcatcaacgtctgcagtcgctggtagtgctgttgaaggtatggggtttgccattccatcaaacgatgttgttgaaatcatcaatcaattagaaaaagatggtaaagttacacgaccagcactaggaatctcaatagcagatcttaatagcctttctagcagcgcaacttctaaattagatttaccagatgaggtcaaatccggtgttgttgtcggtagtgttcagaaaggtatgccagctgacggtaaacttcaagaatatgatgttatcactgagattgatggtaagaaaatcagctcaaaaactgatattcaaaccaatctttacagccatagtatcggagatactatcaaggtaaccttctatcgtggtaaagataagaaaactgtagatcttaaattaacaaaatctacagaagacatatctgattaa"
+
+	_, _, err := FragmentWithOverhangs(gene, 90, 110, []string{}, defaultOverhangs)
+	if err != nil {
+		t.Errorf(err.Error())
+	}
+}