Skip to content

Commit

Permalink
FIX: Indent in comment interpreted as code, not markdown (#31)
Browse files Browse the repository at this point in the history
  • Loading branch information
@PoorRican
PoorRican authored Dec 14, 2024
2 parents 5895b90 + 5100bf7 commit 0c1c186
Show file tree
Hide file tree
Showing 4 changed files with 52 additions and 53 deletions.
2 changes: 1 addition & 1 deletion src/asn/biblio.rs
View file
Original file line number Diff line number Diff line change
Expand Up @@ -286,7 +286,7 @@ pub enum CitSubMedium {
/// Cite a direct data submission
///
/// # Original Comment
/// See "NCBI-Submit" for the form of a direct sequence submission
/// See "NCBI-Submit" for the form of a direct sequence submission
pub struct CitSub {
/// not necessarily authors of the paper
pub authors: AuthList,
Expand Down
13 changes: 6 additions & 7 deletions src/asn/seqalign.rs
View file
Original file line number Diff line number Diff line change
Expand Up @@ -81,18 +81,17 @@ pub struct DenseDiag {
#[derive(Clone, Serialize, Deserialize, PartialEq, Debug)]
/// The densest packing for sequence alignments only.
///
///
/// # Description
///
/// A start of -1 indicates a gap for that sequence of length lens.
///
/// id=100 AAGGCCTTTTAGAGATGATGATGATGATGA
/// id=200 AAGGCCTTTTAG.......GATGATGATGA
/// id=300 ....CCTTTTAGAGATGATGAT....ATGA
/// id=100 AAGGCCTTTTAGAGATGATGATGATGATGA
/// id=200 AAGGCCTTTTAG.......GATGATGATGA
/// id=300 ....CCTTTTAGAGATGATGAT....ATGA
///
/// dim = 3, numseg = 6, ids = { 100, 200, 300 }
/// starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 }
/// lens = { 4, 8, 7, 3, 4, 4 }
/// dim = 3, numseg = 6, ids = { 100, 200, 300 }
/// starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 }
/// lens = { 4, 8, 7, 3, 4, 4 }
///
pub struct DenseSeg {
// TODO: default 2
Expand Down
30 changes: 15 additions & 15 deletions src/asn/seqfeat.rs
View file
Original file line number Diff line number Diff line change
Expand Up @@ -716,15 +716,15 @@ pub struct CdRegion {
/// number of stop codons on above
///
/// ### Original Comment:
/// each code is 64 cells long, in the order where:
/// `T=0, C=1, A=2, G=3, TTT=0, TTC=1, CTA=4, ...`
/// each code is 64 cells long, in the order where:
/// `T=0, C=1, A=2, G=3, TTT=0, TTC=1, CTA=4, ...`
///
/// NOTE: this order does NOT correspond to a [`SeqData`] encoding.
/// It is "natural" to codon usage instead. The value in each cell is
/// the AA coded for start=AA coded only if first in peptide in start
/// array, if codon is not a legitimate start codon, that cell will
/// have the "gap" symbol for that alphabet. Otherwise it will have the
/// AA encoded when that codon is used at the start.
/// NOTE: this order does NOT correspond to a [`SeqData`] encoding.
/// It is "natural" to codon usage instead. The value in each cell is
/// the AA coded for start=AA coded only if first in peptide in start
/// array, if codon is not a legitimate start codon, that cell will
/// have the "gap" symbol for that alphabet. Otherwise it will have the
/// AA encoded when that codon is used at the start.
pub stops: Option<u64>,
}

Expand Down Expand Up @@ -1330,10 +1330,10 @@ pub enum VariantAlleleState {
/// for fields that were moved here, specifically `allele_frequency`, and
/// `quality_codes`:
///
/// The case of multiple alleles for a SNP would be described by
/// parent-features of type `VariationSet.diff_alleles`, where the child
/// features of type `VariationINst`, all at the same location, would
/// describe individual alleles.
/// The case of multiple alleles for a SNP would be described by
/// parent-features of type `VariationSet.diff_alleles`, where the child
/// features of type `VariationINst`, all at the same location, would
/// describe individual alleles.
///
pub struct VariantProperties {
pub version: u64,
Expand Down Expand Up @@ -1789,15 +1789,15 @@ pub enum RnaRefType {
rRNA,

/// ### Original Comment:
/// will become ncRNA, with RNAGen.class = snRNA
/// will become ncRNA, with RNAGen.class = snRNA
snRNA,

/// ### Original Comment:
/// will become ncRNA, with RNAGen.class = snRNA
/// will become ncRNA, with RNAGen.class = snRNA
scRNA,

/// ### Original Comment:
/// will become ncRNA, with RNAGen.class = snRNA
/// will become ncRNA, with RNAGen.class = snRNA
snoRNA,

/// non-coding RNA; subsumes `snRNA`, `scRNA` and `snoRNA`
Expand Down
60 changes: 30 additions & 30 deletions src/asn/seqtable.rs
View file
Original file line number Diff line number Diff line change
Expand Up @@ -63,25 +63,25 @@ pub struct SeqTableColumnInfo {
/// identification of column data in the objects described by the table
pub field_id: Option<ColumnInfoFieldId>,
/// # Original Comment:
/// any column can be identified by ASN.1 text locator string
/// -- with omitted object type.
/// -- examples:
/// -- "data.gene.locus" for SeqFeat.data.gene.locus
/// -- "data.imp.key" for SeqFeat.data.imp.key
/// -- "qual.qual"
/// -- - SeqFeat.qual is SEQUENCE so several columns are allowed
/// -- see also "Q.xxx" special value for shorter qual representation
/// -- "ext.type.str"
/// -- "ext.data.label.str"
/// -- "ext.data.data.int"
/// -- see also "E.xxx" special value for shorter ext representation
/// -- special values start with capital letter:
/// -- "E.xxx" - ext.data.label.str = xxx, ext.data.data = data
/// -- - SeqFeat.ext.data is SEQUENCE so several columns are allowed
/// -- "Q.xxx" - qual.qual = xxx, qual.val = data
/// -- - SeqFeat.qual is SEQUENCE so several columns are allowed
/// -- "D.xxx" - dbxref.id = xxx, dbxref.tag = data
/// -- - SeqFeat.dbxref is SET so several columns are allowed
/// any column can be identified by ASN.1 text locator string
/// -- with omitted object type.
/// -- examples:
/// -- "data.gene.locus" for SeqFeat.data.gene.locus
/// -- "data.imp.key" for SeqFeat.data.imp.key
/// -- "qual.qual"
/// -- - SeqFeat.qual is SEQUENCE so several columns are allowed
/// -- see also "Q.xxx" special value for shorter qual representation
/// -- "ext.type.str"
/// -- "ext.data.label.str"
/// -- "ext.data.data.int"
/// -- see also "E.xxx" special value for shorter ext representation
/// -- special values start with capital letter:
/// -- "E.xxx" - ext.data.label.str = xxx, ext.data.data = data
/// -- - SeqFeat.ext.data is SEQUENCE so several columns are allowed
/// -- "Q.xxx" - qual.qual = xxx, qual.val = data
/// -- - SeqFeat.qual is SEQUENCE so several columns are allowed
/// -- "D.xxx" - dbxref.id = xxx, dbxref.tag = data
/// -- - SeqFeat.dbxref is SET so several columns are allowed
pub field_name: Option<String>,
}

Expand Down Expand Up @@ -116,8 +116,8 @@ pub struct ScaledIntMultiData {
/// Unsure on functionality.
///
/// # Original comment:
/// min/max scaled value
/// should be set if scaled values may not fit in 32-bit signed integer
/// min/max scaled value
/// should be set if scaled values may not fit in 32-bit signed integer
pub min: Option<i32>,
pub max: Option<i32>,
}
Expand All @@ -137,9 +137,9 @@ pub struct ScaledRealMultiData {
/// Unsure on utility.
///
/// # Original comment:
/// Class for serializing bm::bvector<> //[ likely a c++ construct ]
/// see include/util/bitset/bm.h
/// Since bvector<> serialization doesn't keep size we have to add it explicitly
/// Class for serializing bm::bvector<> //[ likely a c++ construct ]
/// see include/util/bitset/bm.h
/// Since bvector<> serialization doesn't keep size we have to add it explicitly
pub struct BVectorData {
pub size: u64,
pub data: Vec<u8>,
Expand Down Expand Up @@ -185,8 +185,8 @@ pub enum SeqTableMultiData {
RealScaled(ScaledRealMultiData),

/// # Original comment:
/// a set of bit, represented as a serialized bvector
/// see include/util/bitset/bm.h
/// a set of bit, represented as a serialized bvector,
/// see include/util/bitset/bm.h
BitVector(BVectorData),

#[serde(rename = "int1")]
Expand Down Expand Up @@ -230,8 +230,8 @@ pub enum SeqTableSparseIndex {
IndexesDelta(Vec<u64>),

/// # Original comment:
/// Bitset of rows with values, as serialized bvector<>,
/// see include/util/bitset/bm.h
/// Bitset of rows with values, as serialized bvector<>,
/// see include/util/bitset/bm.h
BitSetBvector(BVectorData),
}

Expand Down Expand Up @@ -261,14 +261,14 @@ pub struct SeqTable {
///
/// Original comment:
///
/// ... equal to Seq-feat.data variant index
/// ... equal to Seq-feat.data variant index
pub feat_type: usize,

/// subtype of features in this table, ...
///
/// # Original comment:
///
/// ... defined in header SeqFeatData.hpp
/// ... defined in header SeqFeatData.hpp
pub feat_subtype: Option<usize>,

/// number of rows
Expand Down

0 comments on commit 0c1c186

Please sign in to comment.