From eab4404e7d2db35e6e6c9d4d33b47f5bc9eaa1c8 Mon Sep 17 00:00:00 2001
From: Thomas Cokelaer <cokelaer@gmail.com>
Date: Sat, 13 Jan 2024 14:46:07 +0100
Subject: [PATCH] Fix #84 : remove deprecated and old Options

---
 README.rst                                    |   1 +
 pyproject.toml                                |   2 +-
 sequana_pipetools/misc.py                     |   8 +-
 sequana_pipetools/options.py                  | 513 ------------------
 sequana_pipetools/scripts/main.py             |  18 +-
 sequana_pipetools/sequana_manager.py          |   7 +-
 sequana_pipetools/snaketools/errors.py        |  19 +-
 sequana_pipetools/snaketools/module_finder.py |   1 -
 .../snaketools/pipeline_manager.py            |   4 +-
 .../snaketools/sequana_config.py              |   6 +-
 sequana_pipetools/snaketools/slurm.py         |   3 -
 tests/scripts/data/__init__.py                |   0
 tests/scripts/data/config.yaml                |  81 +++
 tests/scripts/test_main.py                    |  28 +-
 tests/snaketools/test_filefactory.py          |   7 +
 tests/snaketools/test_pipeline_manager.py     |   3 +-
 tests/snaketools/test_sequana_config.py       |  16 +-
 tests/test_options.py                         |  82 +--
 18 files changed, 161 insertions(+), 638 deletions(-)
 create mode 100644 tests/scripts/data/__init__.py
 create mode 100644 tests/scripts/data/config.yaml

diff --git a/README.rst b/README.rst
index 3e8c91c..9fcebe7 100644
--- a/README.rst
+++ b/README.rst
@@ -313,6 +313,7 @@ Changelog
 ========= ======================================================================
 Version   Description
 ========= ======================================================================
+0.17.0    * Remove deprecated options and deprecated functions. More tests.
 0.16.9    * Fix slurm sys exit (replaced by print)
           * upadte doc
           * more tests
diff --git a/pyproject.toml b/pyproject.toml
index 56e16c5..f68233c 100644
--- a/pyproject.toml
+++ b/pyproject.toml
@@ -6,7 +6,7 @@ build-backend = "poetry.core.masonry.api"
 #maintainer ?#maintainer email
 [tool.poetry]
 name = "sequana_pipetools"
-version = "0.16.9"
+version = "0.17.0"
 description = "A set of tools to help building or using Sequana pipelines"
 authors = ["Sequana Team"]
 license = "BSD-3"
diff --git a/sequana_pipetools/misc.py b/sequana_pipetools/misc.py
index da3c4a1..6aaa340 100644
--- a/sequana_pipetools/misc.py
+++ b/sequana_pipetools/misc.py
@@ -95,17 +95,17 @@ def print_version(name):
         print(f"sequana_{name} version: ?")
 
     try:
-        version = get_package_version(f"sequana")
+        version = get_package_version("sequana")
         print(f"Sequana version: {version}")
     except Exception:  # pragma: no cover
-        pass
+        print(f"Sequana version: not found")
 
     try:
-        version = get_package_version(f"sequana_pipetools")
+        version = get_package_version("sequana_pipetools")
         print(f"Sequana_pipetools version: {version}")
     except Exception as err:  # pragma: no cover
         print(err)
-        print("Sequana_pipetools version: ?")
+        print("Sequana_pipetools version: not found")
 
     print(Colors().purple("\nHow to help ?\n- Please, consider citing us (see sequana.readthedocs.io)"))
     print(Colors().purple("- Contribute to the code or documentation"))
diff --git a/sequana_pipetools/options.py b/sequana_pipetools/options.py
index 22f30dd..6b156eb 100644
--- a/sequana_pipetools/options.py
+++ b/sequana_pipetools/options.py
@@ -16,20 +16,11 @@
 import shutil
 import sys
 
-from deprecated import deprecated
-
 from sequana_pipetools.snaketools import Pipeline
 
 from .misc import print_version
 
 __all__ = [
-    "GeneralOptions",
-    "InputOptions",
-    "KrakenOptions",
-    "SlurmOptions",
-    "SnakemakeOptions",
-    "TrimmingOptions",
-    "FeatureCountsOptions",
     "ClickGeneralOptions",
     "ClickInputOptions",
     "ClickFeatureCountsOptions",
@@ -37,7 +28,6 @@
     "ClickSlurmOptions",
     "ClickSnakemakeOptions",
     "ClickTrimmingOptions",
-    "before_pipeline",
     "init_click",
     "include_options_from",
     "OptionEatAll",
@@ -160,25 +150,6 @@ def parser_process(value, state):
         return retval
 
 
-@deprecated
-def before_pipeline(NAME):
-    """A function to provide --version and --deps for all pipelines"""
-
-    if "--version" in sys.argv or "-v" in sys.argv:
-        print_version(NAME)
-        sys.exit(0)
-
-    if "--deps" in sys.argv:
-        # Means than sequana must be installed, which we assume if someone uses
-        # a pipeline. so must be here and not global import
-
-        module = Pipeline(NAME)
-        with open(str(module.requirements), "r") as fin:
-            data = fin.read()
-        print("Those software will be required for the pipeline to work correctly:\n{}".format(data))
-        sys.exit(0)
-
-
 class ClickGeneralOptions:
     group_name = "General"
     metadata = {
@@ -248,48 +219,6 @@ def deps_callback(ctx, param, value):
         ctx.exit(0)
 
 
-class GeneralOptions:
-    def __init__(self):
-        pass
-
-    def add_options(self, parser):
-        parser.add_argument(
-            "--run-mode",
-            dest="run_mode",
-            default=None,
-            choices=["local", "slurm"],
-            help="""run_mode can be either 'local' or 'slurm'. Use local to
-                run the pipeline locally, otherwise use 'slurm' to run on a
-                cluster with SLURM scheduler. Other clusters are not maintained.
-                However, you can set to slurm and change the output shell script
-                to fulfill your needs. If unset, sequana searches for the sbatch
-                and srun commands. If found, this is set automatically to
-                'slurm', otherwise to 'local'.
-                """,
-        )
-
-        parser.add_argument("--version", action="store_true", help="Print the version and quit")
-        parser.add_argument("--deps", action="store_true", help="Show the known dependencies of the pipeline")
-        parser.add_argument(
-            "--level",
-            dest="level",
-            default="INFO",
-            choices=["INFO", "DEBUG", "WARNING", "ERROR", "CRITICAL"],
-            help="logging level in INFO, DEBUG, WARNING, ERROR, CRITICAL",
-        )
-        parser.add_argument(
-            "--from-project",
-            dest="from_project",
-            default=None,
-            help="""You can initiate a new analysis run from an existing project.
-                In theory, sequana project have a hidden .sequana directory,
-                which can be used as input. The name of the run directory itself
-                should suffice (if .sequana is found inside). From there,
-                the config file and the pipeline files are copied in your new
-                working directory""",
-        )
-
-
 def guess_scheduler():
     """Guesses whether we are on a SLURM cluster or not.
 
@@ -383,77 +312,6 @@ def __init__(self, working_directory="analysis", caller=None):
         ]
 
 
-class SnakemakeOptions:
-    def __init__(self, group_name="snakemake", working_directory="analysis"):
-        self.group_name = group_name
-        self.workdir = working_directory
-
-    def _default_jobs(self):
-        if guess_scheduler() == "slurm":  # pragma: no cover
-            return 40
-        else:
-            return 4
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name)
-
-        group.add_argument(
-            "--jobs",
-            dest="jobs",
-            default=self._default_jobs(),
-            help="""Number of jobs to run at the same time (default 4 on a local
-                computer, 40 on a SLURM scheduler). This is the --jobs options
-                of Snakemake""",
-        )
-        group.add_argument(
-            "--working-directory",
-            dest="workdir",
-            default=self.workdir,
-            help="""where to save the pipeline and its configuration file and
-            where the analyse can be run""",
-        )
-        group.add_argument(
-            "--force",
-            dest="force",
-            action="store_true",
-            default=False,
-            help="""If the working directory exists, proceed anyway.""",
-        )
-        if "--use-singularity" in sys.argv:  # pragma: no cover
-            print("--use-singularity is deprecated, use --use-apptainer instead.")
-            sys.exit(1)
-
-        group.add_argument(
-            "--use-apptainer",
-            dest="use_apptainer",
-            action="store_true",
-            default=False,
-            help="""If set, pipelines will download apptainer files for all external tools.""",
-        )  # pragma: no cover
-
-        if "--singularity-prefix" in sys.argv:  # pragma: no cover
-            print("--singularity-prefix is deprecated, use --apptainer-prefix instead.")
-            sys.exit(1)
-
-        group.add_argument(
-            "--apptainer-prefix",
-            dest="apptainer_prefix",
-            default=False,
-            help="""If set, pipelines will download apptainer files in this directory otherwise they will be downloaded in the working directory of the pipeline .""",
-        )
-
-        if "--singularity-args" in sys.argv:  # pragma: no cover
-            print("--singularity-args is deprecated, use --apptainer-args instead.")
-            sys.exit(1)
-
-        group.add_argument(
-            "--apptainer-args",
-            dest="apptainer_args",
-            default="",
-            help="""provide any arguments accepted by apptainer. By default, we set -B $HOME:$HOME """,
-        )
-
-
 class ClickInputOptions:
     group_name = "Data"
     metadata = {"name": group_name, "options": ["--input-directory", "--input-pattern", "--input-readtag"]}
@@ -499,46 +357,6 @@ def __init__(self, input_directory=".", input_pattern="*fastq.gz", add_input_rea
             )
 
 
-class InputOptions:
-    def __init__(self, group_name="data", input_directory=".", input_pattern="*fastq.gz", add_input_readtag=True):
-        """
-
-        By default, single-end data sets. If paired, set is_paired to True
-        If so, the add_input_readtag must be set
-        """
-        self.group_name = group_name
-        self.input_directory = input_directory
-        self.input_pattern = input_pattern
-        self.add_input_readtag = add_input_readtag
-
-    def add_options(self, parser):
-        self.group = parser.add_argument_group(self.group_name)
-        self.group.add_argument(
-            "--input-directory",
-            dest="input_directory",
-            default=self.input_directory,
-            # required=True,
-            help="""Where to find the FastQ files""",
-        )
-        self.group.add_argument(
-            "--input-pattern",
-            dest="input_pattern",
-            default=self.input_pattern,
-            help="pattern for the input FastQ files ",
-        )
-
-        if self.add_input_readtag:
-            self.group.add_argument(
-                "--input-readtag",
-                dest="input_readtag",
-                default="_R[12]_",
-                help="""pattern for the paired/single end FastQ. If your files are
-                tagged with _R1_ or _R2_, please set this value to '_R[12]_'. If your
-                files are tagged with  _1 and _2, you must change this readtag
-                accordingly to '_[12]'.""",
-            )
-
-
 class ClickKrakenOptions:
     group_name = "Kraken"
     metadata = {
@@ -573,35 +391,6 @@ def __init__(self, caller=None):
         ]
 
 
-class KrakenOptions:
-    def __init__(self, group_name="section_kraken"):
-        self.group_name = group_name
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name)
-
-        group.add_argument(
-            "--skip-kraken",
-            action="store_true",
-            default=False,
-            help="""If provided, kraken taxonomy is performed. A database must be
-                provided (see below). """,
-        )
-
-        group.add_argument(
-            "--kraken-databases",
-            dest="kraken_databases",
-            type=str,
-            nargs="+",
-            default=[],
-            help="""Path to a valid set of Kraken database(s).
-                If you do not have any, please see https://sequana.readthedocs.io
-                or use sequana_taxonomy --download option.
-                You may use several, in which case, an iterative taxonomy is
-                performed as explained in online sequana documentation""",
-        )
-
-
 class ClickTrimmingOptions:
     group_name = "Trimming"
     metadata = {
@@ -703,209 +492,6 @@ def quality(x):
         ]
 
 
-class TrimmingOptions:
-    description = """
-    This section is dedicated to reads trimming and filtering and adapter
-    trimming. We currently provide supports for Cutadapt/Atropos and FastP tools.
-
-    This section uniformizes the options for such tools
-
-
-    """
-
-    def __init__(self, group_name="section_trimming", software=["cutadapt", "atropos", "fastp"]):
-        self.group_name = group_name
-        self.software = software
-        self.software_default = "fastp"
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name, self.description)
-
-        group.add_argument(
-            "--software-choice",
-            dest="trimming_software_choice",
-            default=self.software_default,
-            choices=self.software,
-            help="""additional options understood by cutadapt""",
-        )
-
-        group.add_argument(
-            "--disable-trimming", action="store_true", default=False, help="If provided, disable trimming "
-        )
-
-        group.add_argument(
-            "--trimming-adapter-read1",
-            dest="trimming_adapter_read1",
-            default="",
-            help="""fastp auto-detects adapters. You may specify the
-adapter sequence specificically for fastp or cutadapt/atropos with option for
-read1""",
-        )
-
-        group.add_argument(
-            "--trimming-adapter-read2",
-            dest="trimming_adapter_read2",
-            default="",
-            help="""fastp auto-detects adapters. You may specify the
-adapter sequence specificically for fastp or cutadapt/atropos with option for
-read1""",
-        )
-
-        group.add_argument(
-            "--trimming-minimum-length",
-            default=20,
-            help="""minimum number of bases required; read discarded
-otherwise. For cutadapt, default is 20 and for fastp, 15. We use 20 for both by
-default.""",
-        )
-
-        def quality(x):
-            x = int(x)
-            if x < 0:
-                raise argparse.ArgumentTypeError("quality must be positive")
-            return x
-
-        group.add_argument(
-            "--trimming-quality",
-            dest="trimming_quality",
-            default=-1,
-            type=quality,
-            help="""Trimming quality parameter depends on the algorithm used by
-the software behind the scene an may vary greatly; consequently, not provide
-a default value. Cutadapt uses 30 by default, fastp uses 15 by default. If
-unset, the rnaseq pipeline set the default to 30 for cutadapt and 15 for fastp""",
-        )
-
-        # Cutadapt specific
-        group.add_argument(
-            "--trimming-cutadapt-mode",
-            dest="trimming_cutadapt_mode",
-            default="b",
-            choices=["g", "a", "b"],
-            help="""Mode used to remove adapters. g for 5', a for 3', b for both
-                5'/3' as defined in cutadapt documentation""",
-        )
-        group.add_argument(
-            "--trimming-cutadapt-options",
-            dest="trimming_cutadapt_options",
-            default=" -O 6 --trim-n",
-            help="""additional options understood by cutadapt. Here, we trim the
-Ns; -O 6 is the minimum overlap length between read and adapter for an adapter
-to be found""",
-        )
-
-
-class CutadaptOptions:  # pragma: no cover
-    description = """
-    This section allows you to trim bases (--cutadapt-quality) with poor
-    quality and/or remove adapters.
-
-    To remove adapters, you can provide the adapters directly as a
-    string (or a file) using  --cutadapt-fwd (AND --cutadapt-rev" for paired-end data).
-
-    If you set the --cutadapt-adapter-choice to 'none', fwd and reverse
-    adapters are set to XXXX (see cutadapt documentation).
-
-    """
-
-    def __init__(self, group_name="section_cutadapt"):
-        self.group_name = group_name
-        print("CutadaptOptions is deprecated. Will be removed in future versions. Use TrimmingOptions instead")
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name, self.description)
-
-        group.add_argument(
-            "--skip-cutadapt",
-            action="store_true",
-            default=False,
-            help="If provided, fastq cleaning and trimming will be skipped",
-        )
-
-        group.add_argument(
-            "--cutadapt-fwd",
-            dest="cutadapt_fwd",
-            default="",
-            help="""Provide a adapter as a string of stored in a
-                FASTA file. If the file exists, we will store it as expected
-                with a preceeding prefix 'file:'""",
-        )
-
-        group.add_argument(
-            "--cutadapt-rev",
-            dest="cutadapt_rev",
-            default="",
-            help="""Provide a adapter as a string of stored in a
-                FASTA file. If the file exists, we will store it as expected
-                with a preceeding prefix 'file:'""",
-        )
-
-        def quality(x):
-            x = int(x)
-            if x < 0:
-                raise argparse.ArgumentTypeError("quality must be positive")
-            return x
-
-        group.add_argument(
-            "--cutadapt-quality",
-            dest="cutadapt_quality",
-            default=30,
-            type=quality,
-            help="""0  means no trimming, 30 means keep bases with quality
-                above 30""",
-        )
-
-        group.add_argument(
-            "--cutadapt-tool-choice",
-            dest="cutadapt_tool_choice",
-            default="cutadapt",
-            choices=["cutadapt", "atropos"],
-            help="Select the prefered tool. Default is cutadapt",
-        )
-
-        group.add_argument(
-            "--cutadapt-mode",
-            dest="cutadapt_mode",
-            default="b",
-            choices=["g", "a", "b"],
-            help="""Mode used to remove adapters. g for 5', a for 3', b for both
-                5'/3' as defined in cutadapt documentation""",
-        )
-
-        group.add_argument(
-            "--cutadapt-options",
-            dest="cutadapt_options",
-            default=" -O 6 --trim-n",
-            help="""additional options understood by cutadapt""",
-        )
-
-    def options(self, options):
-        """ """
-        # do we need to remove adapters at all ?
-        if options.cutadapt_adapter_choice == "none":
-            options.cutadapt_adapter_choice = None
-            options.cutadapt_fwd = "XXXX"
-            options.cutadapt_rev = "XXXX"
-        # or just the universal ones ?
-        elif options.cutadapt_adapter_choice == "universal":
-            options.cutadapt_fwd = "GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGC"
-            options.cutadapt_rev = "TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA"
-        # or do we have a string or files provided for the fwd/rev ?
-        elif options.cutadapt_adapter_choice is None:
-            if options.cutadapt_fwd:
-                # Could be a string or a file. If a file, check the format
-                if os.path.exists(options.cutadapt_fwd):
-                    options.cutadapt_fwd = "file:{}".format(os.path.abspath(options.cutadapt_fwd))
-            if options.cutadapt_rev:
-                # Could be a string or a file. If a file, check the format
-                if os.path.exists(options.cutadapt_rev):
-                    options.cutadapt_rev = "file:{}".format(os.path.abspath(options.cutadapt_rev))
-        elif options.cutadapt_adapter_choice:
-            # nothing to do, the cutadapt rules from sequana will use
-            # the adapter_choice, and fill the fwd/rev automatically
-            pass
-
-
 class ClickFeatureCountsOptions:
     group_name = "Feature Counts"
     metadata = {
@@ -966,55 +552,6 @@ def __init__(self, feature_type="gene", attribute="ID", options=None, strandness
         ]
 
 
-class FeatureCountsOptions:
-    def __init__(self, group_name="feature_counts", feature_type="gene", attribute="ID", options=None, strandness=None):
-        self.group_name = group_name
-        self.feature_type = feature_type
-        self.attribute = attribute
-        self.options = options
-        self.strandness = strandness
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name)
-        group.add_argument(
-            "--feature-counts-strandness",
-            default=self.strandness,
-            help="""0 for unstranded, 1 for stranded and 2 for reversely
-             stranded. If you do not know, let the pipeline guess for you.""",
-        )
-        group.add_argument(
-            "--feature-counts-attribute",
-            default=self.attribute,
-            help="""the GFF attribute to use as identifier. If you do not know,
-             look at the GFF file or use 'sequana summary YOURFILE.gff' command to get
-             information about attributes and  features contained in your annotation file.""",
-        )
-        group.add_argument(
-            "--feature-counts-extra-attributes",
-            default=None,
-            help="""any extra attribute to add in final feature counts files""",
-        )
-        group.add_argument(
-            "--feature-counts-feature-type",
-            default=self.feature_type,
-            help="""the GFF feature type (e.g., gene, exon, mRNA, etc). If you
-             do not know, look at the GFF file or use 'sequana summary
-YOURFILE.gff'. Would you need to perform an analysis on several features, you
-can either build your own custom GFF file (see Please see
-https://github.com/sequana/rnaseq/wiki) or provide several entries separated by
-commas""",
-        )
-        group.add_argument(
-            "--feature-counts-options",
-            default=self.options,
-            help="""Any extra options for feature counts. Note that the -s
-             option (strandness), the -g option (attribute name) and -t options
-            (genetic type) have their own options. If you use still use one of
-            the -s/-g/-t, it will replace the --feature-counts-strandness,
-            --feature-counts-attribute and -feature-counts-feature options respectively""",
-        )
-
-
 class ClickSlurmOptions:
     group_name = "Slurm"
     metadata = {
@@ -1051,53 +588,3 @@ def __init__(self, memory="4G", queue="common", profile=None, caller=None):
                 help="SLURM queue to be used (biomics)",
             ),
         ]
-
-
-class SlurmOptions:
-    def __init__(self, group_name="slurm", memory="4G", queue="common", cores=4, profile=None):
-        """
-
-        ::
-
-            class Options(argparse.ArgumentParser, SlurmOptions):
-                def __init__(self, prog="whatever")
-                    super(Options, self).__init__(usage="todo",
-                        prog="whatever",description=""
-                    self.add_argument(...)
-                    ...
-                    self.add_slurm_options()
-
-        """
-        self.group_name = group_name
-        self.memory = memory
-        self.cores = cores
-        self.queue = queue
-        self.profile = profile
-
-    def add_options(self, parser):
-        group = parser.add_argument_group(self.group_name)
-        group.add_argument(
-            "--slurm-cores-per-job",
-            dest="slurm_cores_per_job",
-            default=self.cores,
-            help="""Number of cores/jobs to be used at the same time.""",
-        )
-        group.add_argument(
-            "--slurm-queue",
-            dest="slurm_queue",
-            default=self.queue,
-            help="SLURM queue to be used (biomics)",
-        )
-        group.add_argument(
-            "--slurm-memory",
-            dest="slurm_memory",
-            default=self.memory,
-            help="""Specify the memory required by default. (default 4G; stands for 4 Gbytes).""",
-        )
-        group.add_argument(
-            "--profile",
-            dest="profile",
-            default=self.profile,
-            choices=["local", "slurm"],
-            help="Create cluster (HPC) profile directory. By default, it uses local profile",
-        )
diff --git a/sequana_pipetools/scripts/main.py b/sequana_pipetools/scripts/main.py
index e9bfc40..6c7bbfa 100644
--- a/sequana_pipetools/scripts/main.py
+++ b/sequana_pipetools/scripts/main.py
@@ -18,6 +18,10 @@
 from pkg_resources import DistributionNotFound
 
 from sequana_pipetools import version
+from sequana_pipetools.misc import url2hash
+from sequana_pipetools.snaketools.errors import PipeError
+from sequana_pipetools.snaketools.pipeline_utils import get_pipeline_statistics
+from sequana_pipetools.snaketools.sequana_config import SequanaConfig
 
 click.rich_click.USE_MARKDOWN = True
 click.rich_click.SHOW_METAVARS_COLUMN = False
@@ -186,6 +190,7 @@ def set_option_file(self, option_name):
     help="""Given a config file, this command creates a draft schema file""",
 )
 @click.option("--slurm-diag", is_flag=True, help="Scans slurm files and get summary information")
+@click.option("--url2hash", type=click.STRING, help="For developers. Convert a URL to hash mame. ")
 def main(**kwargs):
     """Pipetools utilities for the Sequana project (sequana.readthedocs.io)
 
@@ -206,13 +211,16 @@ def main(**kwargs):
     if kwargs["version"]:
         click.echo(f"sequana_pipetools v{version}")
         return
+    elif kwargs["url2hash"]:
+        click.echo(url2hash(kwargs["url2hash"]))
+
     elif kwargs["completion"]:
         if kwargs["force"] is True:
             choice = "y"
-        else:
+        else:  # pragma: no cover
             msg = "This action will replace files stored in ./config/sequana/pipelines. Do you want to proceed y/n: "
             choice = input(msg)
-        if choice != "y":
+        if choice != "y":  # pragma: no cover
             sys.exit(0)
 
         name = kwargs["completion"]
@@ -226,8 +234,6 @@ def main(**kwargs):
             click.echo("    source ~/.config/sequana/pipelines/{}.sh".format(name))
             click.echo("\nto activate the completion")
     elif kwargs["stats"]:
-        from sequana_pipetools.snaketools.pipeline_utils import get_pipeline_statistics
-
         wrappers, rules = get_pipeline_statistics()
         click.echo("\n ==== Number of wrappers per pipeline")
         click.echo(wrappers.sum(axis=0))
@@ -236,14 +242,10 @@ def main(**kwargs):
         click.echo("\n ==== Number of rules used")
         click.echo(rules)
     elif kwargs["config_to_schema"]:
-        from sequana_pipetools.snaketools.sequana_config import SequanaConfig
-
         config_file = kwargs["config_to_schema"]
         cfg = SequanaConfig(config_file)
         cfg.create_draft_schema()
     elif kwargs["slurm_diag"]:
-        from sequana_pipetools.snaketools.errors import PipeError
-
         p = PipeError()
         p.status(".")
 
diff --git a/sequana_pipetools/sequana_manager.py b/sequana_pipetools/sequana_manager.py
index a63b1a5..c1173bb 100644
--- a/sequana_pipetools/sequana_manager.py
+++ b/sequana_pipetools/sequana_manager.py
@@ -18,7 +18,6 @@
 import sys
 from pathlib import Path
 from shutil import which
-from urllib.request import urlretrieve
 
 import aiohttp
 import colorlog
@@ -29,7 +28,7 @@
 from sequana_pipetools.misc import url2hash
 from sequana_pipetools.snaketools.profile import create_profile
 
-from .misc import Colors, PipetoolsException, print_version
+from .misc import Colors, PipetoolsException
 from .snaketools import Pipeline, SequanaConfig
 
 logger = colorlog.getLogger(__name__)
@@ -77,7 +76,7 @@ def __init__(self):
         # have been defined yet.
         try:
             logger.setLevel(options.level)
-        except AttributeError:
+        except AttributeError:  # pragma: no cover
             logger.warning("Your pipeline does not have a level option.")
             options.level = "INFO"
 
@@ -450,7 +449,7 @@ def teardown(self, check_schema=True, check_input_files=True):
             with open(f"{self.workdir}/.sequana/pip.yml", "w") as fout:
                 subprocess.call(cmd.split(), stdout=fout)
             logger.debug("Saved your pip environment into pip.txt (conda not found)")
-        else:
+        else:  # pragma: no cover
             with open(f"{self.workdir}/.sequana/pip.yml", "w") as fout:
                 fout.write("pip not found")
 
diff --git a/sequana_pipetools/snaketools/errors.py b/sequana_pipetools/snaketools/errors.py
index e4fdfc7..be3cda8 100644
--- a/sequana_pipetools/snaketools/errors.py
+++ b/sequana_pipetools/snaketools/errors.py
@@ -12,9 +12,8 @@
 ##############################################################################
 from pathlib import Path
 
-from sequana_pipetools import logger
-
-from .slurm import SlurmParsing
+from sequana_pipetools.options import guess_scheduler
+from sequana_pipetools.snaketools.slurm import SlurmParsing
 
 
 class PipeError:
@@ -24,8 +23,12 @@ def __init__(self, *args, **kwargs):
         pass
 
     def status(self, working_directory="./", logs_directory="logs"):
-        try:  # let us try to introspect the slurm files
-            dj = SlurmParsing(working_directory, logs_directory)
-            print(dj)
-        except Exception as err:  # pragma: no cover
-            print(err)
+
+        if guess_scheduler == "slurm":
+            try:  # let us try to introspect the slurm files
+                dj = SlurmParsing(working_directory, logs_directory)
+                print(dj)
+            except Exception as err:  # pragma: no cover
+                print(err)
+        else:
+            pass
diff --git a/sequana_pipetools/snaketools/module_finder.py b/sequana_pipetools/snaketools/module_finder.py
index 8dd0b4c..7d6c08c 100644
--- a/sequana_pipetools/snaketools/module_finder.py
+++ b/sequana_pipetools/snaketools/module_finder.py
@@ -12,7 +12,6 @@
 ##############################################################################
 import os
 import pkgutil
-import sys
 
 import colorlog
 
diff --git a/sequana_pipetools/snaketools/pipeline_manager.py b/sequana_pipetools/snaketools/pipeline_manager.py
index dc5be8e..00fa9a2 100644
--- a/sequana_pipetools/snaketools/pipeline_manager.py
+++ b/sequana_pipetools/snaketools/pipeline_manager.py
@@ -174,10 +174,10 @@ def get_html_summary(self, float="left", width=30):
 
         vers = get_package_version(f"sequana_{self.name}")
 
-        data = {"samples": len(self.samples), "sequana_{}_version".format(self.name): vers}
+        data = {"samples": len(self.samples), f"sequana_{self.name}_version": vers}
         try:
             data["paired"] = self.paired
-        except AttributeError:
+        except AttributeError:  # pragma: no cover
             pass
 
         df_general = pd.DataFrame(
diff --git a/sequana_pipetools/snaketools/sequana_config.py b/sequana_pipetools/snaketools/sequana_config.py
index 3d952fa..805d89c 100644
--- a/sequana_pipetools/snaketools/sequana_config.py
+++ b/sequana_pipetools/snaketools/sequana_config.py
@@ -10,9 +10,7 @@
 #  Documentation: http://sequana.readthedocs.io
 #  Contributors:  https://github.com/sequana/sequana/graphs/contributors
 ##############################################################################
-import json
 import os
-import shutil
 import warnings
 
 import ruamel.yaml
@@ -102,7 +100,7 @@ def _read_file(self, data):
             with open(data, "r") as fh:
                 import yaml as _yaml
 
-                config = _yaml.load(fh, Loader=_yaml.FullLoader)
+                config = _yaml.safe_load(fh)
             return config
         else:
             raise FileNotFoundError(f"input string must be an existing file {data}")
@@ -186,8 +184,10 @@ def check_config_with_schema(self, schemafile):
         # add custom extensions
         with pkg_resources.path("sequana_pipetools.resources", "ext.py") as ext_name:
             extensions = [str(ext_name)]
+
         # causes issue with ruamel.yaml 0.12.13. Works for 0.15
         warnings.simplefilter("ignore", ruamel.yaml.error.UnsafeLoaderWarning)
+
         try:
             # open the config and the schema file
             with TempFile(suffix=".yaml") as fh:
diff --git a/sequana_pipetools/snaketools/slurm.py b/sequana_pipetools/snaketools/slurm.py
index 7885ac2..9e98ef7 100644
--- a/sequana_pipetools/snaketools/slurm.py
+++ b/sequana_pipetools/snaketools/slurm.py
@@ -10,9 +10,6 @@
 #  Documentation: http://sequana.readthedocs.io
 #  Contributors:  https://github.com/sequana/sequana/graphs/contributors
 ##############################################################################
-import os
-import re
-import sys
 from pathlib import Path
 
 import colorlog
diff --git a/tests/scripts/data/__init__.py b/tests/scripts/data/__init__.py
new file mode 100644
index 0000000..e69de29
diff --git a/tests/scripts/data/config.yaml b/tests/scripts/data/config.yaml
new file mode 100644
index 0000000..832ae81
--- /dev/null
+++ b/tests/scripts/data/config.yaml
@@ -0,0 +1,81 @@
+# ============================================================================
+# Config file for Quality Control
+# ==========================================[ Sections for the users ]========
+#
+# One of input_directory, input_pattern and input_samples must be provided
+# If input_directory provided, use it otherwise if input_pattern provided,
+# use it, otherwise use input_samples.
+# ============================================================================
+
+sequana_wrappers: "v23.11.18"
+
+input_directory: '.'
+input_pattern: '*fastq.gz'
+
+
+# See sequana_pipetools.readthedocs.io for details about these 2 options
+# common prefixes are removed. addition prefixes may be removed here
+#extra_prefixes_to_strip = []
+# in special cases, sample names can be extracted with a pattern
+#sample_pattern: '{sample}.fastq.gz'
+
+
+apptainers:
+    falco: "https://zenodo.org/record/7014954/files/falco_1.0.0.img"
+    fastqc: "https://zenodo.org/record/7923780/files/fastqc_0.12.1.img"
+    graphviz: "https://zenodo.org/record/7928262/files/graphviz_7.0.5.img"
+    multiqc: https://zenodo.org/record/10155626/files/multiqc_1.17.0.img
+
+
+##############################################################################
+# general section
+#
+# Choose one of the standard method to perform QC of your fastq data
+#
+general:
+    method_choice: fastqc
+
+##############################################################################
+# FastQC section
+#
+# :Parameters:
+#
+# - options: string with any valid FastQC options
+fastqc:
+    options: ''
+    threads: 4
+    resources:
+        mem: 8G
+
+##############################################################################
+# Falco section
+#
+# :Parameters:
+#
+# - options: string with any valid FastQC options
+falco:
+    options: ''
+    threads: 4
+    resources:
+        mem: 8G
+
+##############################################################################
+#
+#
+# - options: any multiqc options accepted. Note that if you use --comments, 
+#   it will be appended to the existing --comments added inside sequana. 
+#   By default, -p (create pictures) and -f (for overwritting) are used. 
+# - indir: The input multiqc (default is local).
+multiqc:
+    do: true
+    options: -p -f
+    input_directory: "."
+    modules: fastqc    # falco is not set; the fastqc module works for falco
+    config_file: 
+    resources:
+        mem: 8G
+
+plotting_and_stats:
+    resources:
+        mem: 8G
+
diff --git a/tests/scripts/test_main.py b/tests/scripts/test_main.py
index 7c3618d..b94b6c6 100644
--- a/tests/scripts/test_main.py
+++ b/tests/scripts/test_main.py
@@ -1,10 +1,11 @@
 import sys
 
-import pytest
 from click.testing import CliRunner
 
 from sequana_pipetools.scripts.main import main
 
+from . import test_dir
+
 
 def test_main():
     runner = CliRunner()
@@ -29,3 +30,28 @@ def test_completion(monkeypatch):
     runner = CliRunner()
     results = runner.invoke(main, ["--completion", "fastqc", "--force"])
     assert results.exit_code == 0
+
+
+def test_url2hash():
+    runner = CliRunner()
+    results = runner.invoke(main, ["--url2hash", "test"])
+    assert results.exit_code == 0
+    assert results.output == "098f6bcd4621d373cade4e832627b4f6\n"
+
+
+def test_stats():
+    runner = CliRunner()
+    results = runner.invoke(main, ["--stats"])
+    assert results.exit_code == 0
+
+
+def test_config_to_schema():
+    runner = CliRunner()
+    results = runner.invoke(main, ["--config-to-schema", f"{test_dir}/data/config.yaml"])
+    assert results.exit_code == 0
+
+
+def test_slurm_diag():
+    runner = CliRunner()
+    results = runner.invoke(main, ["--slurm-diag"])
+    assert results.exit_code == 0
diff --git a/tests/snaketools/test_filefactory.py b/tests/snaketools/test_filefactory.py
index f3d6449..4d69c4a 100644
--- a/tests/snaketools/test_filefactory.py
+++ b/tests/snaketools/test_filefactory.py
@@ -41,6 +41,13 @@ def inner_test(ff):
     except ValueError:
         assert True
 
+    try:
+        ff = snaketools.FastQFactory("*dummy___not_possible", verbose=True, read_tag="")
+
+        assert False
+    except ValueError:
+        assert True
+
 
 def test_fastqfactory():
     with pytest.raises(ValueError):
diff --git a/tests/snaketools/test_pipeline_manager.py b/tests/snaketools/test_pipeline_manager.py
index 5529463..a21180a 100644
--- a/tests/snaketools/test_pipeline_manager.py
+++ b/tests/snaketools/test_pipeline_manager.py
@@ -28,7 +28,8 @@ def test_pipeline_manager(tmpdir):
     cfg.config.input_directory, cfg.config.input_pattern = os.path.split(file1)
     pm = snaketools.PipelineManager("custom", cfg)
     assert not pm.paired
-    pm.teardown()
+    working_dir = tmpdir.mkdir("temp")
+    pm.teardown(outdir=working_dir)
 
     # here not readtag provided, so data is considered to be non-fastq related
     # or at least not paired
diff --git a/tests/snaketools/test_sequana_config.py b/tests/snaketools/test_sequana_config.py
index 9797767..b17c062 100644
--- a/tests/snaketools/test_sequana_config.py
+++ b/tests/snaketools/test_sequana_config.py
@@ -7,14 +7,14 @@
 
 from .. import test_dir
 
-# def test_valid_config(tmpdir):
-#    config = SequanaConfig(None)
-#
-#    s = Module("fastqc")
-#    config = SequanaConfig(s.config)
-#    fh = tmpdir.join("config.yml")
-#    config.save(fh)
-#    config.create_draft_schema()
+
+def test_valid_config(tmpdir):
+
+    s = Pipeline("fastqc")
+    config = SequanaConfig(s.config)
+    fh = tmpdir.join("config.yml")
+    config.save(fh)
+    config.create_draft_schema()
 
 
 # this is a regression bug that guarantees that
diff --git a/tests/test_options.py b/tests/test_options.py
index 17cc579..1d9c820 100644
--- a/tests/test_options.py
+++ b/tests/test_options.py
@@ -3,92 +3,12 @@
 
 import pytest
 
-from sequana_pipetools.options import (
-    ClickGeneralOptions,
-    FeatureCountsOptions,
-    KrakenOptions,
-    OptionEatAll,
-    SnakemakeOptions,
-    TrimmingOptions,
-    before_pipeline,
-)
+from sequana_pipetools.options import ClickGeneralOptions, OptionEatAll
 
 # for test_click_general_options() to work we need to define a global variable
 NAME = "TEST"
 
 
-def test_misc():
-
-    sys.argv.append("--version")
-
-    with pytest.raises(SystemExit):
-        before_pipeline("fastqc")
-    sys.argv.remove("--version")
-    sys.argv.append("--deps")
-    with pytest.raises(SystemExit):
-        before_pipeline("fastqc")
-
-
-def test_feature_counts():
-    p = argparse.ArgumentParser()
-    so = FeatureCountsOptions()
-    so.add_options(p)
-
-
-def test_trimming_options():
-
-    p = argparse.ArgumentParser()
-    so = TrimmingOptions()
-    so.add_options(p)
-    p.parse_args(["--trimming-quality", "40"])
-    with pytest.raises(SystemExit):
-        p.parse_args(["--trimming-quality", "-40"])
-
-
-def test_snakemake_options():
-
-    p = argparse.ArgumentParser()
-    so = SnakemakeOptions()
-    so._default_jobs()  # test sheduler
-    so.add_options(p)
-    p.parse_args([])
-
-
-def test_krakenl_options():
-
-    p = argparse.ArgumentParser()
-    so = KrakenOptions()
-    so.add_options(p)
-    p.parse_args([])
-
-
-def test_slurm_options():
-    from sequana_pipetools.options import SlurmOptions
-
-    p = argparse.ArgumentParser()
-    so = SlurmOptions()
-    so.add_options(p)
-    p.parse_args([])
-
-
-def test_input_options():
-    from sequana_pipetools.options import InputOptions
-
-    p = argparse.ArgumentParser()
-    so = InputOptions()
-    so.add_options(p)
-    p.parse_args([])
-
-
-def test_general_options():
-    from sequana_pipetools.options import GeneralOptions
-
-    p = argparse.ArgumentParser()
-    so = GeneralOptions()
-    so.add_options(p)
-    p.parse_args([])
-
-
 def test_click_general_options():
     import rich_click as click