config_example.txt

#Lines with # are considered comments
#general settings

#Desired length of the barcode. Required
desiredBarcodeLength = 20

#Adaptors. The designed barcodes will be checked against interraction with these sequences. Optional
leftAdaptor = ACACTCTTTCCCTACACGACGCTCTTCCGATCT
#rightAdaptor

#Maximum number of bases allowed in a homopolymer. Required
homopolymerLimit = 4

#Minimum GC content of barcode. Required
minGC = 0.45

#Maximum GC content of barcode. Required
maxGC = 0.65

#Temperature of self hybridization. Required. Setting this to -1, will result in no temperature checking.
selfHybridizationTemperature = 50.0

#Temperature at which the hybridization is performed. Required. Setting this to -1 will result in no temperature checking.
hybridizationTemperature = 50.0

#Minimum edit distance between barcodes. Ensure that no two barcodes are closer than this in distance space.
#The higher this number, the more robust the barcodes are to sequencing errors. However, this number also reduces the
#number of possible barcodes. Required
minEditDistance = 4

#Minimum edit distance to self. Required
minEditDistanceSelf = 5

#others
#Handles are going to be checked against hybridization. Optional
<handles>
#Illumina A Handle
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
#Illumina A Handle rev. compl.
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
#Illumina B Handle
#GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
#Illumina B Handle rev. compl.
#AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
</handles>

#Restriction sites. Filter out sequences that contain given site. Optional
<restrictionSites>
#ATTG
</restrictionSites>