NOAA-PMEL-OME-MiFish-mod-Universal-Teleost-12S-PCR-Protocol-BeBOP.md

methodology_category	project	purpose	analyses	geographic_location	broad_scale_environmental_context	local_environmental_context	environmental_medium	target	creator	materials_required	skills_required	time_required	personnel_required	language	issued	audience	publisher	pcr_0_1	thermocycler	amplificationReactionVolume	assay_name	assay_validation	targetTaxonomicAssay	targetTaxonomicScope	target_gene	target_subfragment	ampliconSize	pcr_primer_forward	pcr_primer_reverse	pcr_primer_name_forward	pcr_primer_name_reverse	pcr_primer_reference_forward	pcr_primer_reference_reverse	pcr_primer_vol_forward	pcr_primer_vol_reverse	pcr_primer_conc_forward	pcr_primer_conc_reverse	probeReporter	probeQuencher	probe_seq	probe_ref	probe_conc	commercial_mm	custom_mm	pcr_dna_vol	pcr_rep	nucl_acid_amp	pcr_cond	annealingTemp	pcr_cycles	pcr_analysis_software	pcr_method_additional
Omics analysis	NOAA Pacific Marine Environmental Laboratory Ocean Molecular Ecology Program Protocols	PCR [OBI:0000415]	PCR [OBI:0000415]	North East Pacific Ocean [GAZ:00013765], Bering Sea [GAZ:00008990], Arctic Ocean [GAZ:00000323]	marine biome [ENVO:00000447], marine photic zone [ENVO:00000209]	oceanic epipelagic zone biome [ENVO:01000035], marine biome [ENVO:00000447], marine benthic biome [ENVO:01000024]	sea water [ENVO:00002149]	12S mitochondrial ribosomal RNA [NCIT:C128263], MT-RNR1 Gene [NCIT:C128260]	Shannon Brown, Han Weinrich, Zachary Gold	vortexer [OBI:0400118], PCR instrument [OBI:0000989]	sterile technique, pipetting skills, standard molecular technique	170	1	en	2025-01-05	scientists	NOAA Pacific Marine Environmental Laboratory Ocean Molecular Ecology Program; University of Washington Cooperative Institute for Climate, Ocean, & Ecosystem Studies	1	Applied Biosystems Veriti 96-well thermal cycler	25	mifish_mod_universal_teleost_12s	not provided	12S rRNA gene sequencing targeting the V5-V6 region using primers MiFish-U-F_mod and MiFish-U-R	fishes	12S rRNA	V5-V6	163-185	GCCGGTAAAACTCGTGCCAGC	CATAGTGGGGTATCTAATCCCAGTTTG	MiFish_U_F_mod	MiFish_U_R	https://doi.org/10.1002/edn3.14	http://doi.org/10.1098/rsos.150088	1.25	1.25	10	10	not applicable	not applicable	not applicable	not applicable	not applicable	Phusion High-Fidelity PCR Master Mix with HF Buffer	PCR reactions were run in 25 uL reaction volumes, with 2 uL of DNA, 12.5 uL of AmpliTaq Gold, 6.625 uL of water, 0.625 uL rAlbumin, 0.75 uL DMSO and 1.25 uL of each primer (10 uM).	2	1	Not Provided	initial denaturation:98_0.5;normal_cycling;denaturation:98_0.17;annealing:60_0.5;elongation:72_0.75;final elongation:72_10;35	60	35	not provided	not provided

NOAA PMEL OME MiFish mod Universal Teleost 12S PCR Protocol

PROTOCOL INFORMATION

Minimum Information about an Omics Protocol (MIOP)

• MIOP terms are listed in the YAML frontmatter of this page.
• See https://github.com/BeBOP-OBON/miop/blob/main/model/schema/terms.yaml for list and definitions.

Authors

PREPARED BY	AFFILIATION	ORCID	DATE
Shannon Brown	Ocean Molecular Ecology, NOAA PMEL & UW CICOES	https://orcid.org/0000-0001-9808-2638	2024-02-02
Han Weinrich	Ocean Molecular Ecology, NOAA PMEL & UW CICOES	http://orcid.org/0009-0007-6063-0986	2024-02-02
Sean McAllister	Ocean Molecular Ecology, NOAA PMEL & UW CICOES	http://orcid.org/0000-0001-6654-3495	2024-02-02
Matt Galaska	Ocean Molecular Ecology, NOAA PMEL	http://orcid.org/0000-0002-4257-0170	2024-02-02
Zachary Gold	Ocean Molecular Ecology, NOAA PMEL	http://orcid.org/0000-0003-0490-7630	2024-02-02

• All authors known to have contributed to the preparation of this protocol should be listed, including those who filled in the template.
• Visit https://orcid.org/ to register for an ORCID.

Related Protocols

• This section contains protocols that should be known to users of this protocol.
• Internal Protocols: Derivative or altered protocols, or other protocols in this workflow.
• External Protocols: Protcols from manufacturers or other groups.
• Include the link to each protocol.
• Include the version number (internal) or access date (external) of the protocol when it was accessed.

Internal Protocols

PROTOCOL NAME	LINK	VERSION	RELEASE DATE
OME Gel electrophoresis protocol (in progress)	TBD	0.0	TBD

External Protocols

PROTOCOL NAME	LINK	VERSION	RELEASE DATE
NOAA Northwest Fisheries Science Center & MMARINeDNA: Marine Mammal Remote detection via INnovative environmental DNA sampling MiFish 12S Universal Teleost Protocol	Pending Shaffer et al. 2024 publication		Pending

Protocol Revision Record

VERSION	RELEASE DATE	DESCRIPTION OF REVISIONS
1.0.0	2024-02-01	Initial release
1.0.1	2024-05-29	Formatting edits
1.0.2	2024-10-23	File edits
1.1.0	2025-02-05	Addition of FAIR eDNA terms in YAML frontmatter and formatting edits

• Version numbers start at 1.0.0 when the protocol is first completed and will increase when changes that impact the outcome of the procedure are made (patches: 1.0.1; minor changes: 1.1.0; major changes: 2.0.0).
• Release date is the date when a given protocol version was finalised.
• Description of revisions includes a brief description of what was changed relative to the previous version.

Acronyms and Abbreviations

ACRONYM / ABBREVIATION	DEFINITION
12S rRNA	12S mitochondrial ribosomal RNA
BSC	Biosafety cabinet
CICOES	Cooperative Institute for Climate, Ocean, & Ecosystem Studies
eDNA	environmental DNA
EtOH	Ethanol
IDT	Integrated DNA Technologies
MBARI	Monterey Bay Aquarium Research Institute
MBON	Marine Biodiversity Observation Network
NOAA	National Oceanic and Atmospheric Administration
NTC	No template control
OME	Ocean Molecular Ecology
PCR	Polymerase chain reaction
PMEL	Pacific Marine Environmental Laboratory
PPE	Personal protective equipment
UW	University of Washington
WC-OBON	West Coast Ocean Biomolecular Observing Network

Glossary

SPECIALISED TERM	DEFINITION
Extraction blank	Extraction negative control. Typically nuclease-free water or empty filter run through the DNA extraction process to control for contamination in the DNA extraction step.
Field blank	Sampling negative control. Typically distilled or reverse osmosis water run through a filter like an seawater eDNA sample to control for contamination in the field sampling step.
No template control	PCR negative control. Typically nuclease-free water loaded in place of a sample on a PCR to control for contamination in the PCR step.
Positive control	PCR positive control. Typically a synthetic DNA strand, non-indigenous DNA extract, or intentionally designed mock community loaded in place of a sample on a PCR to control for contamination and index hopping in the PCR step.

BACKGROUND

Summary

This protocol describes steps for performing PCR for the 12S mitochondrial ribosomal RNA gene in vertebrates using eDNA. The primers (forward: MiFish-U-F_mod, reverse: MiFish-U-R) were first presented in Sales et al. 2019 (forward) and Miya et al. 2015 (reverse). The MiFish-U-F_mod primer used in this protocol has 1 basepair substition from the MiFish-U-F primer used in Miya et al. 2015, but is otherwise identical. The target amplicon size is 163 - 185 base pairs.

This primer set targets vertebrates organisms (e.g., fishes, marine mammals, birds). Important note, this primer also amplifies non-target organisms including microbes and single-celled phytoplankton (e.g., proteobacteria and diatoms).

The protocol presented here is intended as the first PCR of a two-step PCR next generation sequencing library preparation using Illumina Nextera Unique Dual Indices. Our written protocol does not include the second PCR step in which unique library-specific barcodes are attached to each round 1 PCR product.

Method description and rationale

This protocol was chosen because it has been tested and deployed at scale by the MMARINeDNA: Marine Mammal Remote detection via INnovative environmental DNA sampling project including both NOAA Northwest Fisheries Science Center (NWFSC) and Southwest Fisheries Science Center (SWFSC) and University of Washington eDNA Collaborative and University of California San Diego Scripps Institution of Oceanography, all leaders in the field of eDNA research and important partners in West Coast Ocean Biomolecular Observing Network (WC-OBON). Our protocol uses the same primers, polymerase, and thermocycling conditions as MMARINeDNA, but is 25 µL in total reaction volume. We intentionally chose this protocol to promote standardization of ocean biomolecular observations and easily facilitate integration of PMEL OME eDNA data with NOAA NMFS led eDNA time series.

This amplification protocol is accessible to most molecular biology labs.

Spatial coverage and environment(s) of relevance

This protocol can be used to amplify the 12S marker gene region of any eDNA sample.

Personnel Required

One person with molecular biology experience.

Safety

This protocol does not involve any hazardous chemicals, although standard precautions including wearing PPE should be taken to avoid skin and eye exposure to chemical reagents.

Training requirements

Molecular biology training (including, at a minimum, sterile technique, pipetting small volumes, and programming and running PCR thermocyclers) is required to conduct this protocol.

Time needed to execute the procedure

PCR preparation and running the PCR protocol for a single 96-well plate takes 2.8 hours (170 minutes), of which 80 mins is the thermocycler run time. Additional plates can be run simultaneously without greatly increasing the time required.

EQUIPMENT

For a 96-well Plate:

DESCRIPTION	PRODUCT NAME AND MODEL	MANUFACTURER	QUANTITY	REMARK
Durable equipment
Pipetter: 1-10 μl	Pipetman P10L	Gilson	1	Can be substituted with any accurate pipettor
Pipetter: 20 - 200 uL	Pipetman P200L	Gilson	1	Can be substituted with any accurate pipettor
Pipetter: 100-1000 uL	Pipetman P1000	Gilson	1	Can be substituted with any accurate pipettor
BioSafety II cabinet	Biological safety cabinet (INT-1100A2)	Kewaunee	1	Can be substituted with generic - internal UV light required
Thermocycler	Veriti 96-well thermal cycler	Applied Biosystems	1	Can be substituted with generic
Mini-centrifuge	Personal mini centrifuge	BioExcell	1	Can be substituted with generic, but needs to fit 1.5-2.0 mL tubes
Vortex	Analog vortex mixer	Fisher Scientific	1	Can be substituted with generic
Plate spinner	Salad spinner	Cuisinart	1	Can be substituted with generic or plate centrifuge
Foil roller	Rubber roller	Generic	1
PCR cooler rack	PCR cooler 0.2-0.5 mL	Eppendorf	1	Can be substituted with generic
1.5 mL tube cooler rack	Benchtop cooler	Thermo Scientific	1	Can be subsituted with generic
2 mL tube rack	Microcentrifuge tube rack	VWR	1	Can be substituted with generic
0.2 mL PCR plate rack	PCR tube rack for 0.2 mL micro-tubes	Fisher Scientific	1	Can be substituted with generic
Wash bottle	Safety Wash Bottle for Ethanol 500mL	VWR	1	Can be substituted with generic - must be sterilized before use
Wash bottle	Safety Wash Bottle for Hypochlorite Bleach 500mL	VWR	1	Can be substituted with generic - must be sterilized before use
Freezer	Freezer capable of reaching and maintaining -20°C	Generic	1	Used to store DNA and PCR reagents NOTE: A separate freezer should be used to store PCR products if possible.
Fridge	Refrigerator capable of reaching and maintaining 4°C	Generic	1	Used to store some PCR reagents NOTE: A separate fridge should be used to hold PCR products if possible.
Trash bag holder	Bel-Art scienceware bench-top biohazard holders	Fisher Scientific	1	Can be substituted with generic
Cryoboxes	TruCool hinged lid cryoboxes	VWR	2	Can be substituted with generic - must be sterilized before use
Consumable equipment
1000 μL pipette tips	TipOne RPT filter tips 1000 μL XL graduated	USA Scientific	4	Can be subsituted with generic - must be sterile and filtered
200 μL pipette tips	TipOne RPT filter tips 200 μL graduated	USA Scientific	4	Can be subsituted with generic - must be sterile and filtered
10 μL pipette tips	TipOne RPT filter tips 10 μL graduated	USA Scientific	96	Can be subsituted with generic - must be sterile and filtered
PCR plates	Twin.tec LoBind PCR plates, semi-skirted (96-wells)	Eppendorf	1	Can be subsituted with generic - must be DNA low retention
PCR aluminum foil	Adhesive sterile PCR foil seals	VWR	2	Can be substituted with generic - must be sterile.
2 mL tubes	Snap cap DNA LoBind 2.0 mL tubes, PCR-clean	Eppendorf	5	Can be substituted with generic - must be sterile.
1.5 mL tubes	Snap cap DNA LoBind 1.5 mL tubes, PCR-clean	Eppendorf	2	Can be substituted with generic - must be sterile.
Kimwipes	Delicate task wipes	Kimtech	5
Nitrile gloves	Powder Free Nitrile Gloves	Fisher Scientific	4	Can be subsituted with generic nitrile gloves. Does not come sterile, must be sterilized before use (10% bleach followed by 70% EtOH)
Trash bags for BSC	Teivio 1.2 Gallon 360 Counts Strong Trash Bags	Teivio	1	Can be substituted with generic.
Lab notebook	Durable, hardcover lab notebook	Generic	1	Dedicated to the lab space
Writing utensils	Sharpies and pens	Generic	2	Dedicated to the lab extraction space. Not made of wood - must be able to be wiped down with bleach/EtOH.
Optional Equipment
Repeater Pipetter: 10-300 μL	E1-ClipTip electronic single channel pipette, 10-300 μL	ThermoFisher	1	Can be substituted with generic - not required but reduces protocol time
300 μl repeater pipette tips	ClipTip 300 filtered sterile tips	Thermo Scientific	2	Can be substituted with generic. Must fit repeater pipette. Must be sterile and filtered.
8-channel multichannel pipetter: 1-10 μL	Pipetman Multichannel P8X10	Gilson	1	Can be substituted with generic. Not required but reduces protocol time.
UV crosslinker	UV crosslinker AH (115V), 234100	Boekel Scientific	1	Recommended not required; can be substituted.
Chemicals
PCR master mix 2x	Phusion High-Fidelity PCR Master Mix with HF Buffer	New England BioLabs	1300 μl per plate	Store at -20°C.
Forward primer	Custom oligo	IDT	130 μl per plate	Store at -20°C.
Reverse primer	Custom oligo	IDT	130 μl per plate	Store at -20°C.
Nuclease free water	UltraPure DNase/RNase-free distilled water	ThermoFisher	689 μl per plate
rAlbumin	Molecular Biology Grade Recombinant Albumin	New England BioLabs	65 μl per plate	Store at -20°C
DMSO	Phusion HF PCR Master Mix comes with DMSO	New England Biolabs	78 μl per plate	Store at 4°C - must be warmed to room temperature to dissolve
Positive control	gBlocks HiFi Gene Fragments	IDT	2 μl per plate	Store at -20°C
70% EtOH	Molecular grade ethanol	Generic	40 mL
10% bleach	Hypochlorite bleach	Clorox	40 mL	Remake every ~5 days as bleach decomposes quickly at 10% concentration.

• Description: E.g., "filter".
• Product Name and Model: Provide the official name of the product.
• Manufacturer: Provide the name of the manufacturer of the product.
• Quantity: Provide quantities necessary for one application of the standard operating procedure (e.g., number of filters).
• Remark: For example, some of the consumable may need to be sterilized, some commercial solution may need to be diluted or shielded from light during the operating procedure.

STANDARD OPERATING PROCEDURE

Protocol

Preparation

1. Sterilize workspaces and durable equipment, including pipettes within the BSC with 10% bleach. Then wipe down all surfaces and equipment with 70% EtOH.
2. If you have a UV crosslinker available, UV pipettes and tube racks regularly for 2 minutes.
3. Run the UV light in the BSC for 30 minutes before starting work.
4. Label all PCR plates both on the side of the plate and on the top of the foil (in the plate margins). Recommended labeling scheme includes plate name, primer, date of PCR and personnel initials.

PCR

Primer Sequences without Adapters(not used): PCR primer sequences (target sequence bolded)

PCR Primer Name	Direction	Sequence (5’ -> 3’)
MiFish-U-F_mod	Forward	GCCGGTAAAACTCGTGCCAGC
MiFish-U-R	Reverse	CATAGTGGGGTATCTAATCCCAGTTTG

Primer Sequences Used: PCR primer sequences with Illumina Adapters (Adapter sequence + target sequence bolded)

PCR Primer Name	Direction	Sequence (5’ -> 3’)
MiFish-U-mod - Nex - F	Forward	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCCGGTAAAACTCGTGCCAGC
MiFish-U - Nex - R	Reverse	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAGTGGGGTATCTAATCCCAGTTTG

Reaction Mixture: PCR reagents, volumes, initial and final concentrations

Reagent	Volume (μL) per plate	Volume (μL) per reaction	Intial concentration	Final concentration
2X Phusion Master Mix	1300	12.5	100%	50%
Forward Primer	130	1.25	10 μM	0.5 μM
Reverse Primer	130	1.25	10 μM	0.5 μM
DMSO	78	0.75	100%	3%
Nuclease-Free Water	689	6.625	N/A	N/A
rAlbumin	65	0.625	20 µg/µL	0.5 µg/µL
Template DNA	N/A	2	100%	8%
Total	2392	25	N/A	N/A

This table breaks down the mixture per plate and per reaction. When running full plates (96-wells), each reagent volume was multipled by 104 (96+8 extra sample volumes to account for pipetting error) when preparing the final master mix.

PCR Cycling Program:

PCR step	Temperature	Duration	Repetition
Initial denaturation	98°C	30s	1X
Normal Cycling
Denaturation	98°C	10s	35X
Annealing	60°C	30s	35X
Extension	72°C	45s	35X
Final extension	72°C	10min	1X
Hold	4°C	∞	1X

Step-by-Step Instructions:

Note: When possible, PCR set-up should be carried out in a separate pre-PCR space that is distinct from where the post-PCR space where thermocyclers are located and all post-PCR processing is performed. No equipment, consumables, or reagents should be shared between pre- and post-PCR spaces with a unidirectional flow of sample processing.

1. Set out primers and positive control to thaw.
2. Vortex and spin down thawed positive control, primers, and nuclease free water. Then tap/flick AmpliTaq rather than vortexing before spinning down. Thawed reagents should be stored in a cooling block or fridge when not in use.
3. Pool reagents to make final master mix, as denoted in above in reagent mixture table.
4. Set out template DNA to thaw if frozen.
5. Aliquot 23 μL of final master mix into each well of the PCR plate. The plate should sit in a cold block to ensure the reagents remain at a low temperature.
6. Add 2 μL DNA template to each well (See Protocol Sample Sheet), but reserve two wells for the positive control and a no template control (NTC).
7. To one well each, add 2 μL of the positive control and 2 μL of nuclease-free water for the NTC.
8. Seal the PCR plate with foil.
9. Spin down the plate, and then transport in cooler blocks before placing in thermocycler.
10. Run thermocycler protocol.

Quality control

1. Plates should be removed from the thermocycler after the run completes and stored at 4°C until run on a gel. Storing the PCR product at -20˚C is ideal for 1-6 month term storage, while -80˚C is ideal for long-term storage.
2. Run gel visualization to confirm successful PCR. [NOAA-PMEL-OME-GelVisualization-Protocol pending]

Positive Control

A positive control is used in every PCR run to verify success of the PCR reaction. In place of template DNA, 2 μL of positive control diluted to 10^3 copies/µL is used. One well per plate is alotted for the positive control. The positive control used for MiFIsh 12S is the extinct Haast Eagle (Harpagornis moorei) native to New Zealand. The reference mitogenome used to develop the positive control sequence can be found on GenBank: Accession MK294166.1. We note that this accession had 3 mismatches in the forward primer and thus we modified the positive control to use the exact primer sequence to avoid mismatches.

Positive Control Sequence
TTAGTTATCGCACTCCTAGGGCCGGTAAAACTCGTGCCAGCCACCGCGGTCATACAAGAGACCCAAGTTAACAGCTGTCCGGCGTAAAGAGCGGGCCCCTACTATCTAAGCAGTCTGGGATTAAACCACGGCTAAGCTGTCATAAGCCCAAGGCGTGTTTAAAGCCACCCCCAAGACGATCCCAACGCCCACGACTAACTAAACCCCGCGAAAGCCAGGGCACAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTAATA

Negative Control

The inclusion of a negative control for PCR is to confirm the absence of contamination during the process.

Nuclease-free water is used as a no template control (NTC) when setting up each PCR plate. One well per plate is alloted to a NTC. NTCs should be run in addition to both field blanks and extraction blanks.

Basic troubleshooting guide

Issue 1: Streaking is observed for sample wells in gel but positive control band appears normal.

Solution: Dilute the sample DNA to a 1:10 dilution with nuclease-free water. If smearing is still observed using a 1:10 dilution, dilute the DNA samples further to a 1:100 dilution. If the samples do not amplify under these conditions the sample likely is inhibited or has too little target DNA and thus is unlikely to yield valuable results. Alternative solutions include cleaning DNA extractions with a commercial clean up kit.

Issue 2: No bands were observed in the PCR, including the positive control.

Solution: The PCR likely failed. Check reagents to confirm they were not mishandled or expired and rerun the PCR. If positive control fails again, reagents or positive control are likely compromised.

Issue 3: Band observed in no template control.

Solution: The PCR was likely contaminated. Sterilize lab space and equipment thoroughly, then rerun with new aliquots of reagents and primers.

Issue 4: Low Volume Post-PCR

Solution: If using strip-caps, ensure they are tightly fitting on wells. Any gap in the lid will allow for some volume to evaporate during the PCR process on the thermal cycler. If using PCR plate seals, spin down the plate after taking it off the thermal cycler to ensure all condensation is drawn back into the well.

Issue 5: Weak Amplification

Solution: If there are weak amplification bands on the gel, ensure the master mix and DNA is being fully mixed. You can also increase the concentration of primers or tweak the PCR process on the thermal cycler (increasing # of cycles of PCR or optimize annealing temperature).

REFERENCES

1. Miya M., Sato Y., Fukunaga T., Sado T., Poulsen J. Y., Sato K., Minamoto T., Yamamoto S., Yamanaka H., Araki H., Kondoh M. and Iwasaki W. 2015MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine speciesR. Soc. Open Sci.2150088150088 http://doi.org/10.1098/rsos.150088
2. Sales NG, Wangensteen OS, Carvalho DC, Mariani S. Influence of preservation methods, sample medium and sampling time on eDNA recovery in a neotropical river. Environmental DNA. 2020; 00: 119–130. https://doi.org/10.1002/edn3.14

APPENDIX A: DATASHEETS

Protocol Sample Sheet