#Info for week 3
##Homework review
Your tasks were to:
- Count the number of A's
- Count the number of T's
- Determine the length of the sequence
- Divide the total number of A's and T's vs the length of the sequence
- Report the percentage of the AT content
##Introduction to UNIX/Command line
- We will cover basic commands
- We will review absolute and relative paths
- We will create and remove files/directories
##Reading and Writing Files (Chapter 3 of Python for Biologists)
- You should be typing examples into a text file.
- Save the text file.
- Execute the text file on the command line using python [name of your text file].
- DO NOT RUN THIS DIRECTLY IN PYTHON (If you see >>> on your terminal you are in python)
##Homework
- Writing a FASTA file
- FASTA file format is a commonly-used DNA and protein sequence file format. A single sequence in FASTA format looks like this:
>sequence_name
ACTAGCTAGCTAGCATCG
- Write a program that will create a MULTI-FASTA file for the following three sequences – make sure that all sequences are in upper case and only contain the bases A, T, G and C.
SEQUENCE HEADER DNA SEQUENCE
ABC123 ATCGTACGATCGATCGATCGCTAGACGTATCG
DEF456 actgatcgacgatcgatcgatcacgact
HIJ789 ACTGAC-ACTGT--ACTGTA----CATGTG- Submit your final script to the proper drop it to me page.
- Your file should be named [yourname].HW3.fasta.py
##Where to send homework
- https://dropitto.me/week3-330
- https://dropitto.me/week3-530
- Password for both is: iLOVEpython
- Homework must be received no later than 12:00 PM on 2/28/17 to receive credit