Skip to content

Commit

Permalink
update Falco + empower the bot (#6290)
Browse files Browse the repository at this point in the history 
* update falco version

* fix lint

* something wired with the autoformat

* update test data
  • Loading branch information
@bgruening
bgruening committed Sep 10, 2024
1 parent e8ac361 commit 900be4e
Show file tree
Hide file tree
Showing 20 changed files with 803 additions and 801 deletions.
12 changes: 7 additions & 5 deletions tools/falco/falco.xml
View file
Original file line number Diff line number Diff line change
@@ -1,10 +1,14 @@
<tool id="falco" name="Falco" version="1.2.2+galaxy1" profile="21.05">
<tool id="falco" name="Falco" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05">
<description>An alternative, more performant implementation of FastQC for high throughput sequence quality control</description>
<macros>
<token name="@TOOL_VERSION@">1.2.3</token>
<token name="@VERSION_SUFFIX@">0</token>
</macros>
<xrefs>
<xref type="bio.tools">falco</xref>
</xrefs>
<requirements>
<requirement type="package" version="1.2.2">falco</requirement>
<requirement type="package" version="@TOOL_VERSION@">falco</requirement>
</requirements>
<command detect_errors="aggressive"><![CDATA[
#import re
Expand Down Expand Up @@ -60,7 +64,7 @@
<param argument="-subsample" type="integer" value="1" min="1" label="Subsampling Factor" help="This makes falco faster (but possibly less accurate) by only processing reads that are multiple of this value (using 0-based indexing to number reads)"/>
<param argument="-bisulfite" type="boolean" truevalue="-bisulfite" falsevalue="" checked="False" label="Bisulfite Sequencing" help="This parameter indicates whether the reads are from whole genome bisulfite sequencing. When enabled, Falco will account for the expected increase in Ts and decrease in Cs in the base content."/>
<param argument="reverse_complement" type="boolean" truevalue="-reverse-complement" falsevalue="" checked="False" label="Reverse Complement" help="This parameter specifies whether the input sequences are reverse-complemented. When enabled, all modules in Falco will be tested by swapping A/T and C/G."/>
<param name="generate_summary" type="boolean" truevalue="" falsevalue="-skip-summary" checked="False" label="Generate summary output of QC test results" />
<param name="generate_summary" type="boolean" truevalue="" falsevalue="-skip-summary" checked="False" label="Generate summary output of QC test results"/>
</inputs>
<outputs>
<data format="html" name="html_file" from_work_dir="fastqc_report.html" label="${tool.name} on ${on_string}: Webpage"/>
Expand Down Expand Up @@ -93,7 +97,6 @@
<output name="html_file" file="fastqc_report_customlimits.html" ftype="html" lines_diff="2"/>
<output name="text_file" file="fastqc_data_customlimits.txt" ftype="txt"/>
</test>

<!-- ## The kmers param is ignored in Falco and always set to 7. If this ever gets reconsidered, this test could be uncommented.
<test expect_num_outputs="2">
<param name="input_file" value="1000trimmed.fastq" ftype="fastq"/>
Expand All @@ -113,7 +116,6 @@
<output name="html_file" file="fastqc_report_min_length.html" ftype="html" lines_diff="2"/>
<output name="text_file" file="fastqc_data_min_length.txt" ftype="txt"/>
</test> -->

<test expect_num_outputs="3">
<param name="input_file" value="1000trimmed.fastq" ftype="fastq"/>
<param name="nogroup" value="--nogroup"/>
Expand Down
222 changes: 111 additions & 111 deletions tools/falco/test-data/fastqc_data.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
##Falco 1.2.2
##Falco 1.2.3
>>Basic Statistics pass
#Measure Value
Filename 1000trimmed_fastq
Expand Down Expand Up @@ -1597,114 +1597,114 @@ Sequence length 1-108
#Sequence Count Percentage Possible Source
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit
>>END_MODULE
>>Adapter Content pass
#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter
1 0 0 0 0 0
2 0 0 0 0 0
3 0 0 0 0 0
4 0 0 0 0 0
5 0 0 0 0 0
6 0 0 0 0 0
7 0 0 0 0 0
8 0 0 0 0 0
9 0 0 0 0 0
10 0 0 0 0 0
11 0 0 0 0 0
12 0 0 0 0 0
13 0 0 0 0 0
14 0 0 0 0 0
15 0 0 0 0 0
16 0 0 0 0 0
17 0 0 0 0 0
18 0 0 0 0 0
19 0 0 0 0 0
20 0.122324 0 0 0 0
21 0.122324 0 0 0 0
22 0.122324 0 0 0 0
23 0.122324 0 0 0 0
24 0.122324 0 0 0 0
25 0.122324 0 0 0 0
26 0.122324 0 0 0 0
27 0.142712 0 0 0 0
28 0.183486 0 0 0 0
29 0.224261 0 0 0 0
30 0.224261 0 0 0 0
31 0.224261 0 0 0 0
32 0.224261 0 0 0 0
33 0.224261 0 0 0 0
34 0.224261 0 0 0 0
35 0.265036 0 0 0 0
36 0.285423 0 0 0 0
37 0.326198 0 0 0 0
38 0.407747 0 0 0 0
39 0.468909 0 0 0 0
40 0.468909 0 0 0 0
41 0.468909 0 0 0 0
42 0.468909 0 0 0 0
43 0.468909 0 0 0 0
44 0.468909 0 0 0 0
45 0.468909 0 0 0 0
46 0.468909 0 0 0 0
47 0.468909 0 0 0 0
48 0.468909 0 0 0 0
49 0.468909 0 0 0 0
50 0.468909 0 0 0 0
51 0.468909 0 0 0 0
52 0.468909 0 0 0 0
53 0.468909 0 0 0 0
54 0.468909 0 0 0 0
55 0.468909 0 0 0 0
56 0.468909 0 0 0 0
57 0.468909 0 0 0 0
58 0.468909 0 0 0 0
59 0.468909 0 0 0 0
60 0.468909 0 0 0 0
61 0.468909 0 0 0 0
62 0.468909 0 0 0 0
63 0.468909 0 0 0 0
64 0.468909 0 0 0 0
65 0.468909 0 0 0 0
66 0.468909 0 0 0 0
67 0.468909 0 0 0 0
68 0.468909 0 0 0 0
69 0.468909 0 0 0 0
70 0.468909 0 0 0 0
71 0.468909 0 0 0 0
72 0.468909 0 0 0 0
73 0.468909 0 0 0 0
74 0.489297 0 0 0 0
75 0.489297 0 0 0 0
76 0.489297 0 0 0 0
77 0.489297 0 0 0 0
78 0.489297 0 0 0 0
79 0.489297 0 0 0 0
80 0.489297 0 0 0 0
81 0.489297 0 0 0 0
82 0.489297 0 0 0 0
83 0.509684 0 0 0 0
84 0.509684 0 0 0 0
85 0.509684 0 0 0 0
86 0.509684 0 0 0 0
87 0.509684 0 0 0 0
88 0.509684 0 0 0 0
89 0.509684 0 0 0 0
90 0.509684 0 0 0 0
91 0.509684 0 0 0 0
92 0.570846 0 0 0 0
93 0.632008 0 0 0 0
94 0.632008 0 0 0 0
95 0.632008 0 0 0 0
96 0.632008 0 0 0 0
97 0.632008 0 0 0 0
98 0.632008 0 0 0 0
99 0.632008 0 0 0 0
100 0.632008 0 0 0 0
101 0.632008 0 0 0 0
102 0.632008 0 0 0 0
103 0.632008 0 0 0 0
104 0.632008 0 0 0 0
105 0.632008 0 0 0 0
106 0.632008 0 0 0 0
107 0.632008 0 0 0 0
108 0.632008 0 0 0 0
>>Adapter Content warn
#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG
1 0 0 0 0 0.0203874 0
2 0 0 0 0 0.0815494 0
3 0 0 0 0 0.142712 0
4 0 0 0 0 0.183486 0
5 0 0 0 0 0.285423 0
6 0 0 0 0 0.38736 0
7 0 0 0 0 0.489297 0
8 0 0 0 0 0.591233 0
9 0 0 0 0 0.672783 0
10 0 0 0 0 0.754332 0
11 0 0 0 0 0.835882 0
12 0 0 0 0 0.917431 0
13 0 0 0 0 1.01937 0
14 0 0 0 0 1.1213 0
15 0 0 0 0 1.24363 0
16 0 0 0 0 1.34557 0
17 0 0 0 0 1.46789 0
18 0 0 0 0 1.59021 0
19 0 0 0 0 1.67176 0
20 0.122324 0 0 0 1.75331 0
21 0.122324 0 0 0 1.83486 0
22 0.122324 0 0 0 1.89602 0
23 0.122324 0 0 0 1.95719 0
24 0.122324 0 0 0 2.01835 0
25 0.122324 0 0 0 2.07951 0
26 0.122324 0 0 0 2.14067 0
27 0.142712 0 0 0 2.20183 0
28 0.183486 0 0 0 2.263 0
29 0.224261 0 0 0 2.32416 0
30 0.224261 0 0 0 2.38532 0
31 0.224261 0 0 0 2.44648 0
32 0.224261 0 0 0 2.50765 0
33 0.224261 0 0 0 2.60958 0
34 0.224261 0 0 0 2.71152 0
35 0.265036 0 0 0 2.81346 0
36 0.285423 0 0 0 2.89501 0
37 0.326198 0 0 0 2.99694 0
38 0.407747 0 0 0 3.09888 0
39 0.468909 0 0 0 3.20082 0
40 0.468909 0 0 0 3.30275 0
41 0.468909 0 0 0 3.40469 0
42 0.468909 0 0 0 3.48624 0
43 0.468909 0 0 0 3.56779 0
44 0.468909 0 0 0 3.60856 0
45 0.468909 0 0 0 3.62895 0
46 0.468909 0 0 0 3.64934 0
47 0.468909 0 0 0 3.66972 0
48 0.468909 0 0 0 3.69011 0
49 0.468909 0 0 0 3.7105 0
50 0.468909 0 0 0 3.7105 0
51 0.468909 0 0 0 3.7105 0
52 0.468909 0 0 0 3.7105 0
53 0.468909 0 0 0 3.7105 0
54 0.468909 0 0 0 3.7105 0
55 0.468909 0 0 0 3.7105 0
56 0.468909 0 0 0 3.7105 0
57 0.468909 0 0 0 3.7105 0
58 0.468909 0 0 0 3.7105 0
59 0.468909 0 0 0 3.73089 0
60 0.468909 0 0 0 3.75127 0
61 0.468909 0 0 0 3.77166 0
62 0.468909 0 0 0 3.81244 0
63 0.468909 0 0 0 3.85321 0
64 0.468909 0 0 0 3.89399 0
65 0.468909 0 0 0 3.93476 0
66 0.468909 0 0 0 3.97554 0
67 0.468909 0 0 0 4.01631 0
68 0.468909 0 0 0 4.05708 0
69 0.468909 0 0 0 4.09786 0
70 0.468909 0 0 0 4.13863 0
71 0.468909 0 0 0 4.17941 0
72 0.468909 0 0 0 4.22018 0
73 0.468909 0 0 0 4.26096 0
74 0.489297 0 0 0 4.32212 0
75 0.489297 0 0 0 4.38328 0
76 0.489297 0 0 0 4.42406 0
77 0.489297 0 0 0 4.46483 0
78 0.489297 0 0 0 4.50561 0
79 0.489297 0 0 0 4.54638 0
80 0.489297 0 0 0 4.58716 0
81 0.489297 0 0 0 4.62793 0
82 0.489297 0 0 0 4.66871 0
83 0.509684 0 0 0 4.70948 0
84 0.509684 0 0 0 4.75025 0
85 0.509684 0 0 0 4.79103 0
86 0.509684 0 0 0 4.8318 0
87 0.509684 0 0 0 4.91335 0
88 0.509684 0 0 0 4.9949 0
89 0.509684 0 0 0 5.05607 0
90 0.509684 0 0 0 5.09684 0
91 0.509684 0 0 0 5.158 0
92 0.570846 0 0 0 5.21916 0
93 0.632008 0 0 0 5.28033 0
94 0.632008 0 0 0 5.34149 0
95 0.632008 0 0 0 5.40265 0
96 0.632008 0 0 0 5.46381 0
97 0.632008 0 0 0 5.52497 0
98 0.632008 0 0 0 5.52497 0
99 0.632008 0 0 0 5.52497 0
100 0.632008 0 0 0 5.52497 0
101 0.632008 0 0 0 5.52497 0
102 0.632008 0 0 0 5.52497 0
103 0.632008 0 0 0 5.52497 0
104 0.632008 0 0 0 5.52497 0
105 0.632008 0 0 0 5.52497 0
106 0.632008 0 0 0 5.52497 0
107 0.632008 0 0 0 5.52497 0
108 0.632008 0 0 0 5.52497 0
>>END_MODULE
2 changes: 1 addition & 1 deletion tools/falco/test-data/fastqc_data_adapters.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
##Falco 1.2.2
##Falco 1.2.3
>>Basic Statistics pass
#Measure Value
Filename 1000trimmed_fastq
Expand Down
Loading

0 comments on commit 900be4e

Please sign in to comment.