From 1589033e65c099db5369c32497c37b7283bc723b Mon Sep 17 00:00:00 2001 From: Usman Rashid Date: Fri, 23 Feb 2024 19:01:37 +1300 Subject: [PATCH] Added fastq_trim_fastp_fastqc --- README.md | 1 - assets/assemblysheet.csv | 4 +- assets/schema_input.json | 17 - modules.json | 15 + modules/nf-core/fastp/environment.yml | 7 + modules/nf-core/fastp/main.nf | 120 +++ modules/nf-core/fastp/meta.yml | 75 ++ modules/nf-core/fastp/tests/main.nf.test | 723 ++++++++++++++++++ modules/nf-core/fastp/tests/main.nf.test.snap | 330 ++++++++ modules/nf-core/fastp/tests/nextflow.config | 6 + modules/nf-core/fastp/tests/tags.yml | 2 + modules/nf-core/fastqc/environment.yml | 7 + modules/nf-core/fastqc/main.nf | 55 ++ modules/nf-core/fastqc/meta.yml | 57 ++ modules/nf-core/fastqc/tests/main.nf.test | 212 +++++ .../nf-core/fastqc/tests/main.nf.test.snap | 88 +++ modules/nf-core/fastqc/tests/tags.yml | 2 + nextflow.config | 2 +- nextflow_schema.json | 9 +- .../nf-core/fastq_trim_fastp_fastqc/main.nf | 106 +++ .../nf-core/fastq_trim_fastp_fastqc/meta.yml | 108 +++ tests/stub/assemblysheet.csv | 4 +- tests/stub/stub.config | 2 + workflows/assemblyqc.nf | 32 +- 24 files changed, 1954 insertions(+), 30 deletions(-) create mode 100644 modules/nf-core/fastp/environment.yml create mode 100644 modules/nf-core/fastp/main.nf create mode 100644 modules/nf-core/fastp/meta.yml create mode 100644 modules/nf-core/fastp/tests/main.nf.test create mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap create mode 100644 modules/nf-core/fastp/tests/nextflow.config create mode 100644 modules/nf-core/fastp/tests/tags.yml create mode 100644 modules/nf-core/fastqc/environment.yml create mode 100644 modules/nf-core/fastqc/main.nf create mode 100644 modules/nf-core/fastqc/meta.yml create mode 100644 modules/nf-core/fastqc/tests/main.nf.test create mode 100644 modules/nf-core/fastqc/tests/main.nf.test.snap create mode 100644 modules/nf-core/fastqc/tests/tags.yml create mode 100644 subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf create mode 100644 subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml diff --git a/README.md b/README.md index 79ec186f..a8c9da60 100644 --- a/README.md +++ b/README.md @@ -73,7 +73,6 @@ Prepare an `assemblysheet.csv` file with following columns representing target a - `fasta:` FASTA file - `gff3 [Optional]:` GFF3 annotation file if available - `monoploid_ids [Optional]:` A txt file listing the IDs used to calculate LAI in monoploid mode if necessary -- `hic_reads [Optional]:` A SRA id such as 'SRR8238190' or path to paired reads such as 'PG_PETUNIA_HiC_CGYCF_CACTCA_L001_R{1,2}.fastq.gz' - `synteny_labels [Optional]:` A two column tsv file listing fasta sequence ids (first column) and labels for the synteny plots (second column) when performing synteny analysis Now, you can run the pipeline using: diff --git a/assets/assemblysheet.csv b/assets/assemblysheet.csv index d8801b5f..19333351 100644 --- a/assets/assemblysheet.csv +++ b/assets/assemblysheet.csv @@ -1,2 +1,2 @@ -tag,fasta,gff3,monoploid_ids,hic_reads,synteny_labels -FI1,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.fna.gz,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.gff.gz,,, +tag,fasta,gff3,monoploid_ids,synteny_labels +FI1,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.fna.gz,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.gff.gz,, diff --git a/assets/schema_input.json b/assets/schema_input.json index 88f9a89b..981c7786 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -35,23 +35,6 @@ } ] }, - "hic_reads": { - "errorMessage": "HiC reads should either be provided as a SRA ID or as a path to paired reads with pattern '*R{1,2}.(fastq|fq).gz'", - "anyOf": [ - { - "type": "string", - "pattern": "^SR\\w+$" - }, - { - "type": "string", - "pattern": "^\\S+R\\{1,2\\}\\.f(ast)?q\\.gz$" - }, - { - "type": "string", - "maxLength": 0 - } - ] - }, "synteny_labels": { "errorMessage": "Synteny labels tsv path cannot contain spaces and must have extension '.tsv'", "anyOf": [ diff --git a/modules.json b/modules.json index d9161f6a..d68ea0ee 100644 --- a/modules.json +++ b/modules.json @@ -90,6 +90,16 @@ "git_sha": "89ff95427f695086369d7927a3c17cea2a37a382", "installed_by": ["modules"] }, + "fastp": { + "branch": "master", + "git_sha": "003920c7f9a8ae19b69a97171922880220bedf56", + "installed_by": ["fastq_trim_fastp_fastqc"] + }, + "fastqc": { + "branch": "master", + "git_sha": "f4ae1d942bd50c5c0b9bd2de1393ce38315ba57c", + "installed_by": ["fastq_trim_fastp_fastqc"] + }, "gunzip": { "branch": "master", "git_sha": "3a5fef109d113b4997c9822198664ca5f2716208", @@ -133,6 +143,11 @@ "branch": "master", "git_sha": "2b21fbeb20ad9f17612f4a3dd7b12971513f08d5", "installed_by": ["subworkflows"] + }, + "fastq_trim_fastp_fastqc": { + "branch": "master", + "git_sha": "cfd937a668919d948f6fcbf4218e79de50c2f36f", + "installed_by": ["subworkflows"] } } } diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml new file mode 100644 index 00000000..70389e66 --- /dev/null +++ b/modules/nf-core/fastp/environment.yml @@ -0,0 +1,7 @@ +name: fastp +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastp=0.23.4 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf new file mode 100644 index 00000000..2a3b679e --- /dev/null +++ b/modules/nf-core/fastp/main.nf @@ -0,0 +1,120 @@ +process FASTP { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' : + 'biocontainers/fastp:0.23.4--h5f740d0_0' }" + + input: + tuple val(meta), path(reads) + path adapter_fasta + val save_trimmed_fail + val save_merged + + output: + tuple val(meta), path('*.fastp.fastq.gz') , optional:true, emit: reads + tuple val(meta), path('*.json') , emit: json + tuple val(meta), path('*.html') , emit: html + tuple val(meta), path('*.log') , emit: log + path "versions.yml" , emit: versions + tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail + tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : "" + def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : '' + // Added soft-links to original fastqs for consistent naming in MultiQC + // Use single ended for interleaved. Add --interleaved_in in config. + if ( task.ext.args?.contains('--interleaved_in') ) { + """ + [ ! -f ${prefix}.fastq.gz ] && ln -sf $reads ${prefix}.fastq.gz + + fastp \\ + --stdout \\ + --in1 ${prefix}.fastq.gz \\ + --thread $task.cpus \\ + --json ${prefix}.fastp.json \\ + --html ${prefix}.fastp.html \\ + $adapter_list \\ + $fail_fastq \\ + $args \\ + 2> >(tee ${prefix}.fastp.log >&2) \\ + | gzip -c > ${prefix}.fastp.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g") + END_VERSIONS + """ + } else if (meta.single_end) { + """ + [ ! -f ${prefix}.fastq.gz ] && ln -sf $reads ${prefix}.fastq.gz + + fastp \\ + --in1 ${prefix}.fastq.gz \\ + --out1 ${prefix}.fastp.fastq.gz \\ + --thread $task.cpus \\ + --json ${prefix}.fastp.json \\ + --html ${prefix}.fastp.html \\ + $adapter_list \\ + $fail_fastq \\ + $args \\ + 2> >(tee ${prefix}.fastp.log >&2) + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g") + END_VERSIONS + """ + } else { + def merge_fastq = save_merged ? "-m --merged_out ${prefix}.merged.fastq.gz" : '' + """ + [ ! -f ${prefix}_1.fastq.gz ] && ln -sf ${reads[0]} ${prefix}_1.fastq.gz + [ ! -f ${prefix}_2.fastq.gz ] && ln -sf ${reads[1]} ${prefix}_2.fastq.gz + fastp \\ + --in1 ${prefix}_1.fastq.gz \\ + --in2 ${prefix}_2.fastq.gz \\ + --out1 ${prefix}_1.fastp.fastq.gz \\ + --out2 ${prefix}_2.fastp.fastq.gz \\ + --json ${prefix}.fastp.json \\ + --html ${prefix}.fastp.html \\ + $adapter_list \\ + $fail_fastq \\ + $merge_fastq \\ + --thread $task.cpus \\ + --detect_adapter_for_pe \\ + $args \\ + 2> >(tee ${prefix}.fastp.log >&2) + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g") + END_VERSIONS + """ + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end + def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz" + def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : "" + """ + touch $touch_reads + touch "${prefix}.fastp.json" + touch "${prefix}.fastp.html" + touch "${prefix}.fastp.log" + $touch_merged + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml new file mode 100644 index 00000000..c22a16ab --- /dev/null +++ b/modules/nf-core/fastp/meta.yml @@ -0,0 +1,75 @@ +name: fastp +description: Perform adapter/quality trimming on sequencing reads +keywords: + - trimming + - quality control + - fastq +tools: + - fastp: + description: | + A tool designed to provide fast all-in-one preprocessing for FastQ files. This tool is developed in C++ with multithreading supported to afford high performance. + documentation: https://github.com/OpenGene/fastp + doi: 10.1093/bioinformatics/bty560 + licence: ["MIT"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information. Use 'single_end: true' to specify single ended or interleaved FASTQs. Use 'single_end: false' for paired-end reads. + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. If you wish to run interleaved paired-end data, supply as single-end data + but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module. + - adapter_fasta: + type: file + description: File in FASTA format containing possible adapters to remove. + pattern: "*.{fasta,fna,fas,fa}" + - save_trimmed_fail: + type: boolean + description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz` + - save_merged: + type: boolean + description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: The trimmed/modified/unmerged fastq reads + pattern: "*fastp.fastq.gz" + - json: + type: file + description: Results in JSON format + pattern: "*.json" + - html: + type: file + description: Results in HTML format + pattern: "*.html" + - log: + type: file + description: fastq log file + pattern: "*.log" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" + - reads_fail: + type: file + description: Reads the failed the preprocessing + pattern: "*fail.fastq.gz" + - reads_merged: + type: file + description: Reads that were successfully merged + pattern: "*.{merged.fastq.gz}" +authors: + - "@drpatelh" + - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test new file mode 100644 index 00000000..9b3f9a38 --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -0,0 +1,723 @@ +nextflow_process { + + name "Test Process FASTP" + script "../main.nf" + process "FASTP" + tag "modules" + tag "modules_nfcore" + tag "fastp" + + test("test_fastp_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end") } + ) + } + } + + test("test_fastp_single_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end_stub") } + ) + } + } + + test("test_fastp_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end") } + ) + } + } + + test("test_fastp_paired_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end-stub") } + ) + } + } + + test("fastp test_fastp_interleaved") { + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 198"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved") } + ) + } + } + + test("fastp test_fastp_interleaved-stub") { + + options '-stub' + + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved-stub") } + ) + } + } + + test("test_fastp_single_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged") } + ) + } + } + + test("test_fastp_paired_end_merged-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } + ) + } + } +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap new file mode 100644 index 00000000..b4c0e1dd --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -0,0 +1,330 @@ +{ + "fastp test_fastp_interleaved_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.123035" + }, + "test_fastp_paired_end_merged-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:10:13.467574" + }, + "versions_interleaved": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:24.615634793" + }, + "test_fastp_single_end_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.223817" + }, + "versions_paired_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:42.333545689" + }, + "test_fastp_paired_end_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:06.431833729" + }, + "test_fastp_interleaved-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:37.827323085" + }, + "test_fastp_paired_end_merged_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:08:44.496251446" + }, + "versions_single_end_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:27.354051299" + }, + "versions_interleaved-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:46.535528418" + }, + "versions_single_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:03.724591407" + }, + "test_fastp_paired_end-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:07:15.398827" + }, + "versions_paired_end-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:06.50017282" + }, + "versions_single_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:07.67921647" + }, + "versions_paired_end_merged_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:47.350653154" + }, + "test_fastp_interleaved-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.127974" + }, + "versions_paired_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:18.140484878" + }, + "test_fastp_single_end-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.244202" + }, + "test_fastp_single_end-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:57:30.791982648" + }, + "versions_paired_end_merged_adapterlist": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:05:37.845370554" + }, + "versions_paired_end_merged": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:32.860543858" + }, + "test_fastp_single_end_trim_fail_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:41.942317" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config new file mode 100644 index 00000000..0f7849ad --- /dev/null +++ b/modules/nf-core/fastp/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + withName: FASTP { + ext.args = "--interleaved_in" + } +} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml new file mode 100644 index 00000000..c1afcce7 --- /dev/null +++ b/modules/nf-core/fastp/tests/tags.yml @@ -0,0 +1,2 @@ +fastp: + - modules/nf-core/fastp/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 00000000..1787b38a --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,7 @@ +name: fastqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf new file mode 100644 index 00000000..9e19a74c --- /dev/null +++ b/modules/nf-core/fastqc/main.nf @@ -0,0 +1,55 @@ +process FASTQC { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" + + input: + tuple val(meta), path(reads) + + output: + tuple val(meta), path("*.html"), emit: html + tuple val(meta), path("*.zip") , emit: zip + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + // Make list of old name and new name pairs to use for renaming in the bash while loop + def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } + def rename_to = old_new_pairs*.join(' ').join(' ') + def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') + """ + printf "%s %s\\n" $rename_to | while read old_name new_name; do + [ -f "\${new_name}" ] || ln -s \$old_name \$new_name + done + + fastqc \\ + $args \\ + --threads $task.cpus \\ + $renamed_files + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.html + touch ${prefix}.zip + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml new file mode 100644 index 00000000..ee5507e0 --- /dev/null +++ b/modules/nf-core/fastqc/meta.yml @@ -0,0 +1,57 @@ +name: fastqc +description: Run FastQC on sequenced reads +keywords: + - quality control + - qc + - adapters + - fastq +tools: + - fastqc: + description: | + FastQC gives general quality metrics about your reads. + It provides information about the quality score distribution + across your reads, the per base sequence content (%A/C/G/T). + You get information about adapter contamination and other + overrepresented sequences. + homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ + documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ + licence: ["GPL-2.0-only"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - html: + type: file + description: FastQC report + pattern: "*_{fastqc.html}" + - zip: + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 00000000..70edae4d --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,212 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("sarscov2 single-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_single") } + ) + } + } + + test("sarscov2 paired-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + ) + } + } + + test("sarscov2 interleaved [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + ) + } + } + + test("sarscov2 paired-end [bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + ) + } + } + + test("sarscov2 multiple [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + ) + } + } + + test("sarscov2 custom_prefix") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + ) + } + } + + test("sarscov2 single-end [fastq] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.html.collect { file(it[1]).getName() } + + process.out.zip.collect { file(it[1]).getName() } + + process.out.versions ).match("fastqc_stub") } + ) + } + } + +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 00000000..86f7c311 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,88 @@ +{ + "fastqc_versions_interleaved": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:07.293713" + }, + "fastqc_stub": { + "content": [ + [ + "test.html", + "test.zip", + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:31:01.425198" + }, + "fastqc_versions_multiple": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:55.797907" + }, + "fastqc_versions_bam": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:40:26.795862" + }, + "fastqc_versions_single": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:39:27.043675" + }, + "fastqc_versions_paired": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:39:47.584191" + }, + "fastqc_versions_custom_prefix": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-31T17:41:14.576531" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml new file mode 100644 index 00000000..7834294b --- /dev/null +++ b/modules/nf-core/fastqc/tests/tags.yml @@ -0,0 +1,2 @@ +fastqc: + - modules/nf-core/fastqc/** diff --git a/nextflow.config b/nextflow.config index ec565e3c..cf50c3f7 100644 --- a/nextflow.config +++ b/nextflow.config @@ -43,7 +43,7 @@ params { kraken2_db_path = null // HiC options - hic_skip = true + hic = null hic_skip_fastp = false hic_skip_fastqc = false hic_fastp_ext_args = '--qualified_quality_phred 20 --length_required 50' diff --git a/nextflow_schema.json b/nextflow_schema.json index add593cc..fcbfcbd1 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -183,10 +183,11 @@ "description": "", "default": "", "properties": { - "hic_skip": { - "type": "boolean", - "default": true, - "description": "Skip HiC contact map construction" + "hic": { + "type": "string", + "description": "HiC reads", + "help_text": "Path to reads provided as a SRA ID or as a path to paired reads with pattern '*R{1,2}.(fastq|fq).gz'", + "pattern": "^SR\\w+$|^\\S+R\\{1,2\\}\\.f(ast)?q\\.gz$" }, "hic_skip_fastp": { "type": "boolean", diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf b/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf new file mode 100644 index 00000000..39a086ad --- /dev/null +++ b/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf @@ -0,0 +1,106 @@ +// +// Read QC and trimming +// + +include { FASTQC as FASTQC_RAW } from '../../../modules/nf-core/fastqc/main' +include { FASTQC as FASTQC_TRIM } from '../../../modules/nf-core/fastqc/main' +include { FASTP } from '../../../modules/nf-core/fastp/main' + +// +// Function that parses fastp json output file to get total number of reads after trimming +// +import groovy.json.JsonSlurper + +def getFastpReadsAfterFiltering(json_file) { + def Map json = (Map) new JsonSlurper().parseText(json_file.text).get('summary') + return json['after_filtering']['total_reads'].toLong() +} + +workflow FASTQ_TRIM_FASTP_FASTQC { + take: + ch_reads // channel: [ val(meta), path(reads) ] + ch_adapter_fasta // channel: [ path(fasta) ] + val_save_trimmed_fail // value: boolean + val_save_merged // value: boolean + val_skip_fastp // value: boolean + val_skip_fastqc // value: boolean + + main: + + ch_versions = Channel.empty() + + ch_fastqc_raw_html = Channel.empty() + ch_fastqc_raw_zip = Channel.empty() + if (!val_skip_fastqc) { + FASTQC_RAW ( + ch_reads + ) + ch_fastqc_raw_html = FASTQC_RAW.out.html + ch_fastqc_raw_zip = FASTQC_RAW.out.zip + ch_versions = ch_versions.mix(FASTQC_RAW.out.versions.first()) + } + + ch_trim_reads = ch_reads + ch_trim_json = Channel.empty() + ch_trim_html = Channel.empty() + ch_trim_log = Channel.empty() + ch_trim_reads_fail = Channel.empty() + ch_trim_reads_merged = Channel.empty() + ch_fastqc_trim_html = Channel.empty() + ch_fastqc_trim_zip = Channel.empty() + if (!val_skip_fastp) { + FASTP ( + ch_reads, + ch_adapter_fasta, + val_save_trimmed_fail, + val_save_merged + ) + ch_trim_reads = FASTP.out.reads + ch_trim_json = FASTP.out.json + ch_trim_html = FASTP.out.html + ch_trim_log = FASTP.out.log + ch_trim_reads_fail = FASTP.out.reads_fail + ch_trim_reads_merged = FASTP.out.reads_merged + ch_versions = ch_versions.mix(FASTP.out.versions.first()) + + // + // Filter empty FastQ files after adapter trimming so FastQC doesn't fail + // + ch_trim_reads + .join(ch_trim_json) + .map { meta, reads, json -> + if (json.text.readLines().size < 1) { + return [ meta, reads ] + } + + if (getFastpReadsAfterFiltering(json) > 0) { + [ meta, reads ] + } + } + .set { ch_trim_reads } + + if (!val_skip_fastqc) { + FASTQC_TRIM ( + ch_trim_reads + ) + ch_fastqc_trim_html = FASTQC_TRIM.out.html + ch_fastqc_trim_zip = FASTQC_TRIM.out.zip + ch_versions = ch_versions.mix(FASTQC_TRIM.out.versions.first()) + } + } + + emit: + reads = ch_trim_reads // channel: [ val(meta), path(reads) ] + trim_json = ch_trim_json // channel: [ val(meta), path(json) ] + trim_html = ch_trim_html // channel: [ val(meta), path(html) ] + trim_log = ch_trim_log // channel: [ val(meta), path(log) ] + trim_reads_fail = ch_trim_reads_fail // channel: [ val(meta), path(fastq.gz) ] + trim_reads_merged = ch_trim_reads_merged // channel: [ val(meta), path(fastq.gz) ] + + fastqc_raw_html = ch_fastqc_raw_html // channel: [ val(meta), path(html) ] + fastqc_raw_zip = ch_fastqc_raw_zip // channel: [ val(meta), path(zip) ] + fastqc_trim_html = ch_fastqc_trim_html // channel: [ val(meta), path(html) ] + fastqc_trim_zip = ch_fastqc_trim_zip // channel: [ val(meta), path(zip) ] + + versions = ch_versions.ifEmpty(null) // channel: [ path(versions.yml) ] +} diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml b/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml new file mode 100644 index 00000000..9f4e12e0 --- /dev/null +++ b/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml @@ -0,0 +1,108 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "fastq_trim_fastp_fastqc" +description: Read QC, fastp trimming and read qc +keywords: + - qc + - quality_control + - adapters + - trimming + - fastq +components: + - fastqc + - fastp +input: + - ch_reads: + type: file + description: | + Structure: [ val(meta), path (reads) ] + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ], List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. If you wish to run interleaved paired-end data, supply as single-end data + but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module. + - ch_adapter_fasta: + type: file + description: | + Structure: path(adapter_fasta) + File in FASTA format containing possible adapters to remove. + - val_save_trimmed_fail: + type: boolean + description: | + Structure: val(save_trimmed_fail) + Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz` + - val_save_merged: + type: boolean + description: | + Structure: val(save_merged) + Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` + - val_skip_fastqc: + type: boolean + description: | + Structure: val(skip_fastqc) + skip the fastqc process if true + - val_skip_fastp: + type: boolean + description: | + Structure: val(skip_fastp) + skip the fastp process if true +output: + - meta: + type: value + description: Groovy Map containing sample information e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + Structure: [ val(meta), path(reads) ] + The trimmed/modified/unmerged fastq reads + - trim_json: + type: file + description: | + Structure: [ val(meta), path(trim_json) ] + Results in JSON format + - trim_html: + type: file + description: | + Structure: [ val(meta), path(trim_html) ] + Results in HTML format + - trim_log: + type: file + description: | + Structure: [ val(meta), path(trim_log) ] + fastq log file + - trim_reads_fail: + type: file + description: | + Structure: [ val(meta), path(trim_reads_fail) ] + Reads the failed the preprocessing + - trim_reads_merged: + type: file + description: | + Structure: [ val(meta), path(trim_reads_merged) ] + Reads that were successfully merged + - fastqc_raw_html: + type: file + description: | + Structure: [ val(meta), path(fastqc_raw_html) ] + Raw fastQC report + - fastqc_raw_zip: + type: file + description: | + Structure: [ val(meta), path(fastqc_raw_zip) ] + Raw fastQC report archive + - fastqc_trim_html: + type: file + description: | + Structure: [ val(meta), path(fastqc_trim_html) ] + Trimmed fastQC report + - fastqc_trim_zip: + type: file + description: | + Structure: [ val(meta), path(fastqc_trim_zip) ] + Trimmed fastQC report archive + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@Joon-Klaps" +maintainers: + - "@Joon-Klaps" diff --git a/tests/stub/assemblysheet.csv b/tests/stub/assemblysheet.csv index dd67ad3b..69b0eb4f 100644 --- a/tests/stub/assemblysheet.csv +++ b/tests/stub/assemblysheet.csv @@ -1,2 +1,2 @@ -tag,fasta,gff3,monoploid_ids,hic_reads,synteny_labels -FI1,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.fna.gz,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.gff.gz,https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/tests/stub/FI1.monoploid.seqs.txt,"https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/docs/test_files/hic/stub_hic.R{1,2}.fq.gz",https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/FI1.seq.labels.tsv +tag,fasta,gff3,monoploid_ids,synteny_labels +FI1,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.fna.gz,https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/003/814/445/GCA_003814445.1_ASM381444v1/GCA_003814445.1_ASM381444v1_genomic.gff.gz,https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/tests/stub/FI1.monoploid.seqs.txt,https://raw.githubusercontent.com/plant-food-research-open/assemblyqc/dev/FI1.seq.labels.tsv diff --git a/tests/stub/stub.config b/tests/stub/stub.config index 4f8a1ce5..5664ccc0 100644 --- a/tests/stub/stub.config +++ b/tests/stub/stub.config @@ -20,6 +20,8 @@ params { kraken2_skip = false kraken2_db_path = 'tests/stub/kraken2/k2_minusb_20231009.tar.gz' + hic = 'tests/stub/hic/Dummy_hic.R{1,2}.fq.gz' + // Limit resources so that this can run on GitHub Actions max_cpus = 2 max_memory = '6.GB' diff --git a/workflows/assemblyqc.nf b/workflows/assemblyqc.nf index f82c3a34..48e3c7d2 100644 --- a/workflows/assemblyqc.nf +++ b/workflows/assemblyqc.nf @@ -50,6 +50,7 @@ include { GUNZIP as GUNZIP_FASTA } from '../modules/nf-core/gunzip/ma include { GUNZIP as GUNZIP_GFF3 } from '../modules/nf-core/gunzip/main' include { FASTAVALIDATOR } from '../modules/nf-core/fastavalidator/main' include { FASTA_EXPLORE_SEARCH_PLOT_TIDK } from '../subworkflows/nf-core/fasta_explore_search_plot_tidk/main' +include { FASTQ_TRIM_FASTP_FASTQC } from '../subworkflows/nf-core/fastq_trim_fastp_fastqc/main' include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoftwareversions/main' @@ -70,7 +71,7 @@ workflow ASSEMBLYQC { ch_input = Channel.fromSamplesheet('input') ch_target_assemby_branch = ch_input - | map { tag, fasta, gff, mono_ids, reads, labels -> + | map { tag, fasta, gff, mono_ids, labels -> [ [ id: tag ], file(fasta, checkIfExists: true) ] } | branch { meta, fasta -> @@ -79,7 +80,7 @@ workflow ASSEMBLYQC { } ch_assemby_gff3_branch = ch_input - | map { tag, fasta, gff, mono_ids, reads, labels -> + | map { tag, fasta, gff, mono_ids, labels -> gff ? [ [ id: tag ], file(gff, checkIfExists: true) ] : null @@ -90,12 +91,23 @@ workflow ASSEMBLYQC { } ch_mono_ids = ch_input - | map { tag, fasta, gff, mono_ids, reads, labels -> + | map { tag, fasta, gff, mono_ids, labels -> mono_ids ? [ [ id: tag ], file(mono_ids, checkIfExists: true) ] : null } + ch_hic_reads = !params.hic + ? Channel.empty() + : ( + "$params.hic".find(/.*[\/].*\.(fastq|fq)\.gz/) + ? Channel.fromFilePairs(params.hic, checkIfExists: true) + : Channel.fromSRA(params.hic) + ) + | map{ sample, fq -> + [ [ id: sample, single_end: false ], fq ] + } + // MODULE: GUNZIP as GUNZIP_FASTA GUNZIP_FASTA ( ch_target_assemby_branch.gz ) @@ -352,6 +364,20 @@ workflow ASSEMBLYQC { ch_kraken2_plot = FASTA_KRAKEN2.out.plot ch_versions = ch_versions.mix(FASTA_KRAKEN2.out.versions) + // SUBWORKFLOW: FASTQ_TRIM_FASTP_FASTQC + + FASTQ_TRIM_FASTP_FASTQC( + ch_hic_reads, + [], + true, // val_save_trimmed_fail + false, // val_save_merged + params.hic_skip_fastp, + params.hic_skip_fastqc + ) + + ch_cleaned_paired_reads = FASTQ_TRIM_FASTP_FASTQC.out.reads + ch_versions = ch_versions.mix(FASTQ_TRIM_FASTP_FASTQC.out.versions) + // MODULE: CUSTOM_DUMPSOFTWAREVERSIONS CUSTOM_DUMPSOFTWAREVERSIONS ( ch_versions.unique().collectFile(name: 'collated_versions.yml')